-
No products found
because this supplier's products are not listed.
I-Ting Teng, et al.,
bioRxiv - Immunology 2021
Quote:
... AWY101 yeast expressing Fabs were cultured in SGCAA media (Teknova) with 2 g/L dextrose (SGDCAA ...
-
Cat# HY-136179-10 mM * 1 mL,
10 mM * 1 mL, USD $198.0
Ask
Murphy Angelo, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The m6A Fab was set up without and with 1 mM m6A nucleoside (MedChemExpress, HY-N0086). Crystals were observed by 4 weeks in the following conditions ...
-
No products found
because this supplier's products are not listed.
Shireen A. Sarraf, et al.,
bioRxiv - Cell Biology 2019
Quote:
... mouse antibodies used for immunofluorescence include ubiquitin FK2 (Biomol International, PW8810-0500). Secondary AlexaFluor® (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Zhouyi Rong, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mouse Interferon Gamma (IFNg) ELISA Kit (RD-IFNg-Mu, Reddot biotech), Mouse Interleukin 6 (IL6 ...
-
Recombinant Mouse Antibody (79D) Fab Fragment is specific to Kit. The inhibitory KIT antibody...
Cat# PFBL-637,
Inquiry
Ask
Teresita Padilla-Benavides, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The Mouse anti-BRD9 antibody (1H8, CBMAB-0174-YC) was from Creative Biolabs. The Rabbit anti-PBRM (Baf180 ...
-
No products found
because this supplier's products are not listed.
Caterina Ivaldo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and specific secondary antibodies (anti rabbit/anti mouse IgG-HRP, Euroclone S.p.A, Italy). The blotting membranes were reprobed with loading control antibodies ...
-
No products found
because this supplier's products are not listed.
Zhibin Zhang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The human heterodimeric Gβ1γ2 was expressed in Spodoptera frugiperda Sf9 insect cells and the anti-Bril Fab was expressed in secreted form from Trichuplusia ni Hi5 insect cells using the baculovirus method (Expression Systems), respectively ...
-
No products found
because this supplier's products are not listed.
Congcong Wang, et al.,
bioRxiv - Microbiology 2019
Quote:
... The FAB medium was in a 10-mL gas-tight syringe and fluid flow was driven by a syringe pump (Harvard Apparatus, Holliston, Phd2000).
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Fan Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The corresponding secondary antibodies (HRP-conjugated goat anti-rabbit or goat anti-mouse, 1:5000, CoWin Biosciences) were probed for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Zumu Yi, Yeyu Liu, Jing Wang, Chen Hu, Yi Man,
bioRxiv - Cell Biology 2023
Quote:
... the cell solutions were co-incubated with FITC Goat Anti-Mouse IgG (H+L) Antibody (APExBIO, K1201,1:400) and APC Anti-Rabbit IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Tongcui Ma, et al.,
bioRxiv - Microbiology 2023
Quote:
... or conjugated in-house with X8 antibody-labeling kits (Standard BioTools) and stored at 4°C in Antibody Stabilizer (Boca Scientific) supplemented with 0.05% sodium azide ...
-
No products found
because this supplier's products are not listed.
Marion Le Rochais, et al.,
bioRxiv - Immunology 2022
Quote:
... tissues were incubated with a secondary antibody coupled to horseradish peroxidase (Polink-1 HRP for Rabbit & Mouse – GBI Labs Kit / AffiniPure Goat Anti-Rat IgG −112-005-143 ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
ZAP-70 Antibody is a Mouse Monoclonal against ZAP-70.
Cat# abx139944-0.1MG,
0.1 mg USD $348.0
Ask
M Hazime, et al.,
bioRxiv - Neuroscience 2022
Quote:
GABA concentrations in the extracellular medium of astrocytes was determined using the Mouse GABA ELISA Kit (Abbexa, Ltd.) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Vikas Arige, et al.,
bioRxiv - Physiology 2022
Quote:
... The IP3R1 antibody (#ARC154, Antibody Research Corporation) was used at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Bader Al Alwan, et al.,
bioRxiv - Biophysics 2020
Quote:
The fluorescence imaging experiment of CD44 on the MβCD-treated fixed KG1a cells was conducted in a way similar to that on the fixed control KG1a cells by using a combination of the anti-CD44 antibody and the Alexa-Fluor-647-conjugated anti-mouse secondary antibody.22 The cells were injected into poly-L-ornithine-coated microfluidic chambers (ibidi GmbH, sticky-slide VI 0.4) using the syringe pump and incubated overnight at 4°C.
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Huasheng Yu, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and secondary antibody (AAT Bioquest iFluroTM Alexa 488 goat antirabbit IgG Cat ...
-
No products found
because this supplier's products are not listed.
Xiyuan Bai, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-CTLA-4 neutralizing antibody and non-immune human IgG antibody were purchased from BPS Bioscience Inc (San Diego ...
-
No products found
because this supplier's products are not listed.
Daniel J. Rawle, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse serum was collected in Microvette 500 Z gel tubes (Sarstedt) with GzmA levels determined using a GzmA ELISA kit (MyBioSource ...
-
No products found
because this supplier's products are not listed.
J. Tabitha Hees, Angelika B. Harbauer,
bioRxiv - Neuroscience 2023
Quote:
Primary mouse cortical neurons were seeded in 6 well plates (Greiner) at a density of 2*106 per well and maintained in NB+B27+PSG as described above ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Liwei Yang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 50 μL of 1 mg/mL antibodies were reacted with 1 μL of 10 mM UV-cleavable azido-NHS ester (30 equivalents to antibodies; Click Chemistry Tools) for 2 h ...
-
No products found
because this supplier's products are not listed.
Melina Krautwurst, et al.,
bioRxiv - Genomics 2023
Quote:
... and the corresponding chemical kit (SCIEX). The peak scoring was done with the provided software (GenomeLab ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Mohamad M. Kronfol, et al.,
bioRxiv - Genetics 2020
Quote:
The TruChIP tissue shearing kit (Covaris, Woburn, MA) was used to process 80 mg of mouse liver per sample ...
-
No products found
because this supplier's products are not listed.
Giovanny J. Martínez-Colón, et al.,
bioRxiv - Immunology 2021
Quote:
... n2019-nCoV (Biosearch technologies, KIT-NCOV-PP1-1000). For subgenomic N-gene quantification ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Sirisha Thippabhotla, Cuncong Zhong, Mei He,
bioRxiv - Bioengineering 2019
Quote:
The RNA library was prepared by using the commercial library preparation kit NEXTflex small RNA sequencing kit (Bioo Scientific, NOVA-5132-05) following the recommended protocol by the manufactures ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Cameron Vergato, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-mouse IFNAR-1 antibody or mouse IgG (cat. #MS-GF-ED, Molecular Innovations, Novi, MI) diluted in sterile PBS and injected i.p ...
-
No products found
because this supplier's products are not listed.
Fabrizio Clarelli, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and CRP (Mouse α-E. coli CRP, 664304, Nordic Biosite antibodies) were diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
Wenjuan Du, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3 μl of spike-Fab complex was applied to glow-discharged (20 mAmp, 30 sec, Quorum GloQube) Quantifoil R1.2/1.3 grids (Quantifoil Micro Tools GmbH), blotted for 5 s using blot force 2 and plunge frozen into liquid ethane using Vitrobot Mark IV (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...