1 - 23 of 23
suppliers found for
Ezrin
» view 79 matched products-
MedChemExpress Sponsored
Cat# HY-P70295-10 μg, 10 μg, USD $120.0 Ask
-
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... anti-Ezrin (Cell Signaling) and anti-galectin 3 (ThermoFisher) ... -
Santa Cruz
No products found because this supplier's products are not listed.Cited in Ultrastructural insight into SARS-CoV-2 attachment, entry and budding in human airway epitheliumbioRxiv - Microbiology 2021Quote: ... Ezrin (Santa Cruz) were used ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Cellular Signalling doi: 10.1016/j.cellsig.2017.09.001Quote: ... Ezrin (BD Biosciences, 610603), Cleaved Caspase 8 (Cell Signaling Technology ... -
abcam
No products found because this supplier's products are not listed.Cited in Nanotopography enhances dynamic remodeling of tight junction proteins through cytosolic complexesbioRxiv - Cell Biology 2019Quote: ... and anti-Ezrin (Abcam #ab4069) were used for specific immunostaining ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Journal of Cell Science doi: 10.1242/jcs.222042Quote: ... anti-ezrin (E8897, Sigma-Aldrich), anti-N-cadherin (for Westerns ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018Quote: ... Six pre-miRNA sequences for Ezrin (Ezrin-miRNA) and negative control sequence (NC-miRNA) were designed (Invitrogen’s RNAi Designer), synthesized and cloned into pAAV⋅CMV_bGI⋅mCherry⋅miRNAi vector (Taitool Bioscience) ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Biophysics 2021Quote: ... mEmerald-Ezrin was from Addgene (#54090). EGFP-IRSp53-FL (62) ... -
Calbiochem
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... the Ezrin Inhibitor NSC668394 (50 μM, Calbiochem), Y27632 (25 μM ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... Ezrin constructs in pEGFP-C2 (Clontech): hEzrin wildtype (EGFP-Ezrin/WT ... -
System Biosciences
No products found because this supplier's products are not listed.Cited in RhoA effectors LOK/SLK activate ERM proteins to locally inhibit RhoA and define apical morphologybioRxiv - Cell Biology 2020Quote: ... ezrin and LOK cDNAs were subcloned into pCDH lentivector (System Biosciences). Puromycin gene in pCDH was then substituted for blasticidin using Gibson assembly ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2022Quote: ... we inserted the designed sgRNA to target exon-1 of Ezrin (TGGCTGGTTGGTGGCTCTGCGTGGGT) (Genscript: NM_001271663.1_T3). Finally ... -
Carl Zeiss
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: We performed FRAP experiments for ezrin-EGFP using an LSM510 microscope (Carl Zeiss, Jena, Germany) equipped with a C-Apochromat ×40 1.2 NA W Corr ... -
MatTek
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020, published in Journal of Cell Science doi: 10.1242/jcs.255307Quote: ... HEK293T cells were transfected with Ezrin-GFP in 35mm glass bottom culture dishes (MatTek #P35GC-0-14-C) as described before ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... The shRNA constructs targeting mouse ezrin (5’-ATTTCCTTGTTATAATCTCCG-3’) in a pLKO-puro.1 vector from GE Healthcare and described in 27 ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Nature Communications doi: 10.1038/s41467-019-10644-9Quote: ... PTPN21-FERM and Ezrin-FERM were pre-spun at 100,000 ×g for 10 min in an Airfuge (Beckman Coulter). 6 nM KIF1C-GFP was incubated with either Ni-NTA elution buffer or 1.25 μM PTPN21-FERM or 1.25 μM Ezrin-FERM for 15 min at room temperature ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... Then they were transfected with 2 μg of plasmid carrying siRNA resistant ezrin (described in (34)) per 8 μl FuGENE HD transfection reagent (Roche) according to the manufacturer’s protocol ... -
antibodies-online
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2021Quote: ... for one h at room temperature and then incubated overnight at four °C with primary mouse antibodies for ezrin (Antibodies-Online, ABIN5542456, Aachen, Germany), with primary rabbit antibodies for GLT-1 (Abcam ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2022Quote: ... Primary antibodies with various dilutions (Ezrin, Cell Signaling Technology 3145S, 1:250; NaK ATPase, DSHB A5-s, 1:50; TOM20, ProteinTech 11802-1-AP, 1:250) were diluted in PBS containing 1% BSA and 0.3% Triton-X for 1 hr at 37°C ... -
MedChemExpress
Cat# HY-P70295-10 μg, 10 μg, USD $120.0No citation found on bioRxiv -
Cohesion Biosciences
Rabbit polyclonal antibody to EzrinCat# CPA2226, 200 ul USD $350.0, 100 ul USD $220.0, 30 ul USD $110.0No citation found on bioRxiv -
Abbexa Ltd.
Cat# abx011643, 100 µg, USD $406.0No citation found on bioRxiv -
Bimake
No citation found on bioRxiv -
Alfa Chemistry
affinity isolated antibody, buffered aqueous solutionCat# IAR42413821, InquireNo citation found on bioRxiv