-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
Heather Schiller, et al.,
bioRxiv - Microbiology 2023
Quote:
... Pop-out transformants were selected on agar plates containing 5-fluoroorotic acid (FOA) (Toronto Research Chemicals Inc.) at a final concentration of 50 μg mL-1 ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Agnieszka Szmitkowska, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and grown on vertically oriented plates for five more days prior to imaging with the Axiolab 5 (Carl Zeiss Microscopy, GmbH). To determine the AHK5-dependent ethylene effect on the root cap ...
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Stahl, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Rainbow Calibration particles (RCP-60-5-2, RCP-60-5-5) were obtained from Spherotech. FITC and PE stained beads were part of the three color BD CaliBRITE kit (BD Biosciences 340486) ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
... black walled 96-well plates (0.5-1.5×104 cells/well) and Cell Navigator™ Lysosome Staining Kit (AAT Bioquest) was used according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lucy Nevard, et al.,
bioRxiv - Biophysics 2021
Quote:
... to transduce the vibrations to the flower by fixing a metal rod to the vibrating plate of the speaker and attaching a pair of very fine tipped forceps (Fine Science Tools, Dumont #5 Biology Tip Inox Forceps) to the end of the rod ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Lieke Koornneef, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... washed (5 × 5 min PBS-T) and scanned using Odyssey CLx imaging system (LI-COR).
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... and blocked with ELISA diluent (5% nonfat milk [LabScientific, Danvers, MA, USA] in PBS-T) for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Sarah E. Wolf, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... We conducted qPCR on 384-well plates (ABI Quantstudio 5, Foster City, CA). For each sample ...
-
No products found
because this supplier's products are not listed.
Tao Ni, et al.,
bioRxiv - Microbiology 2022
Quote:
... Seeding cells were maintained in liquid ATCC medium 290 or on ATCC 290 1.5% agar plates and inoculate in the Vishniac and Santer medium 40 in a 5-liter fermenter (BioFlo 115, New Brunswick Scientific, US) and were kept at constant pH 7.6 through supplement of 3 M KOH ...
-
No products found
because this supplier's products are not listed.
Erin E. Price, et al.,
bioRxiv - Microbiology 2021
Quote:
... two microliters of the cell suspension were spotted onto TSA plates containing 5% defibrinated rabbit blood (HemoStat Laboratories). For lipase assays ...
-
No products found
because this supplier's products are not listed.
Stefan J.A. Remmers, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Each bioreactor was placed in an incubator (37 °C, 5 % CO2) on a magnetic stirrer plate (RTv5, IKA, Germany) rotating at 300 RPM [24] ...
-
No products found
because this supplier's products are not listed.
Kiryl D. Piatkevich, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Five voltage pulses (50 V, 50 ms duration, 1 Hz) were delivered using 5 mm round plate electrodes (ECM™ 830 electroporator, Harvard Apparatus), placing anode or cathode on the top of the skull to target cortex or hippocampus ...
-
BIONOVA X Bioprinting multi-well plates are the key to high throughput DLP printing. Available...
Cat# D16110025295,
12 well, USD $285.0
Ask
Patrick Carmody, et al.,
bioRxiv - Biochemistry 2023
Quote:
... in a humidified incubator containing 5% CO2 at 37°C on culture plates coated with PureCol purified bovine collagen (Advanced BioMatrix, Carlsbad, CA). CFBE41o-cells were transfected using Lipofectamine 3000 (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Maikke B. Ohlson, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-EU was labeled in permeabilized cells using the Click & Go Kit (Click Chemistry Tools #1263) with 2 μM Alexa Fluor 488 azide (Click Chemistry tools #1275 ...
-
No products found
because this supplier's products are not listed.
Nir Salinas, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Incubated bacteria (5 μl) were dispersed on 5×5 mm silicon wafers (Ted Pella, USA) that had been prewashed with ethanol ...
-
No products found
because this supplier's products are not listed.
Uriel López-Sánchez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... solubilized at 5 mg/mL in 5% DDM (Anatrace). After 30 minutes incubation ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Anita K. Nivedha, et al.,
bioRxiv - Biophysics 2021
Quote:
... 96-well white plates (BrandTech). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Bryce M. Connors, et al.,
bioRxiv - Systems Biology 2022
Quote:
... skirted PCR plates (Thomas Scientific) using an acoustic liquid handling robot (Echo LabCyte) ...
-
No products found
because this supplier's products are not listed.
D. Lapaillerie, et al.,
bioRxiv - Microbiology 2020
Quote:
... 0.5 ml of peripheral blood was added to 5 ml of specific culture medium (ChromoSynchroPTM kit, EuroClone, Pero, Italy), T-lymphocytes were thereby cultured for 72 hours ...
-
No products found
because this supplier's products are not listed.
Costanza Borrelli, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 96 or 384 well plates were coated with rat tail collagen with the Collagen-I Cell Culture Surface Coating Kit (ScienCell Research Laboratories) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adam Taheraly, et al.,
bioRxiv - Microbiology 2023
Quote:
... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
No products found
because this supplier's products are not listed.
Ana Sousa-Ortega, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... mounted in FluoroDish 35 mm plates (WPI) and imaged in a Leica SP5 microscope using a 20x multi-immersion objective ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... QX-314 (5 mM, HelloBio) was added to the pipette solution.
-
No products found
because this supplier's products are not listed.
Sarah Hofmann, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 ug/ml insulin (PromoCell), 0.5 ug/ml Hydrocortisone ...
-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5(6)-CTAMRA (Carbosynth/Novabiochem); TFA (Alfa Aesar) ...
-
No products found
because this supplier's products are not listed.
Anthony R. Braun, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Compounds (0.5 μl) were transferred from mother plates into assay plates using a Mosquito HV liquid handler (TTP Labtech Ltd, UK). The preparations for aSyn FRET biosensors were carried out as above.
-
No products found
because this supplier's products are not listed.
Shanlin Rao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% DOPS (Avanti Polar Lipids) was dried under a nitrogen stream and put under vacuum overnight ...
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...