-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Jonathan M. Goodwin, et al.,
bioRxiv - Cell Biology 2021
Quote:
... supplemented with sodium dodecyl sulfate (SDS, Boston BioProducts) to 1% final concentration ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Marco Schade, et al.,
bioRxiv - Paleontology 2022
Quote:
... 2 & 3 (Figs. 1–3; Supplementary Figs. 1–4) was performed using a Metrotom 1500 (Carl Zeiss Microscopy GmbH, Jena, Germany) in a subsidiary of Zeiss in Essingen ...
-
No products found
because this supplier's products are not listed.
Sheryl Roberts, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Cy7 azide (no sulfate groups) was purchased from Lumiprobe (Hallandale Beach, FL).
-
No products found
because this supplier's products are not listed.
Rafael D. González-Cruz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... transferred to a 24-well polystyrene plate (see Fig. 1(c)) (CELLTREAT), and equilibrated with complete cortical media for 48 hours at 37°C prior to cell seeding ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
Mahshid Rahmat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... we synthesized e1 and e4 DNA sequences (GENEWIZ, Cambridge, MA), either containing WT or deleted TF binding sites ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Charlotte F. Chao, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 0.5 g magnesium sulfate heptahydrate (MAG511.1, BioShop Canada), 4.9 mL propionic acids (P1386 ...
-
No products found
because this supplier's products are not listed.
Ye Li, et al.,
bioRxiv - Biophysics 2022
Quote:
... microsphere dispersion (Polybead sulfate, 1.1 µm diameter, Polyscience Inc.) was mixed with rhamnolipid (final concentration of rhamnolipids ...
-
No products found
because this supplier's products are not listed.
Dong Hun Lee, et al.,
bioRxiv - Physiology 2022
Quote:
Human pulmonary artery endothelial cells HPAEC (3 × 105/well) derived from 3 separate individuals were cultured in 6 well plates with ECM media (ScienCell, Carlsbad, CA) then treated with TGF-β (10 ng/ml) ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Stevick, et al.,
bioRxiv - Microbiology 2023
Quote:
... kanamycin sulfate at 400 µg/mL (PAN BIOTECH P06-04010P) and amphotericin B solution at 250 µg/mL (Sigma-Aldrich A2942) ...
-
No products found
because this supplier's products are not listed.
Gema M. Olivarria, et al.,
bioRxiv - Microbiology 2021
Quote:
... Mac2/ Galactin-3 (1:500, CL8942AP Cedarlane), CD4 (1:200 Abcam) ...
-
No products found
because this supplier's products are not listed.
Krysta L. Engel, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The Click reaction was then performed by incubating cells with 100 µL Click buffer (100 µM copper sulfate, 2 mM THPTA, 10 mM fresh sodium ascorbate, 10 µM Cy5 picolyl azide (Click Chemistry Tools 1171-1)) for 1 hour at 37°C in the dark ...
-
No products found
because this supplier's products are not listed.
Thomas A. Packard, et al.,
bioRxiv - Cell Biology 2021
Quote:
HLAC cells were stimulated for 3 days with plates coated with 10 µg/mL anti-CD3 (UCHT1, Tonbo Biosciences) and 10 µg/mL anti-CD28 (CD28.2 ...
-
No products found
because this supplier's products are not listed.
Katelyn H. McKown, et al.,
bioRxiv - Plant Biology 2022
Quote:
... stratified on ½ MS plates (Caisson labs, 1% Agar, pH 5.7) for 4-6 days at 4°C and transferred to a growth chamber set to long day conditions (16 h/8 h light/dark ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
BIONOVA X Bioprinting multi-well plates are the key to high throughput DLP printing. Available...
Cat# D16110025295,
12 well, USD $285.0
Ask
Angela Papalamprou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... PDMS plates were coated with Collagen-1 (Purecol®, Advanced Biomatrix), following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Kevin R. Trabbic, et al.,
bioRxiv - Immunology 2021
Quote:
β-1,3(1-6) glucan (Yeast Beta Glucan, Megazyme, Bray, Ireland; 3 mg) was suspended in 4.9 mL MilliQ H2O contaning 100 μL of 1 M NaOH ...
-
No products found
because this supplier's products are not listed.
Jennifer O’Brien, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and chicken anti-beta-tubulin 3 (Aves Labs, TUJ-0020, 1:500).
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
Vinblastine, Sulfate Salt (Alkaban-AQ, Exal, 29060-LE, NSC-49842, Rozevin sulfate, Velban, Velbe, Velsar, Vincaleucoblastine sulfate, Vincaleukoblastine sulfate, VLB sulfate, CAS 143-67-9), >99%
LC Laboratories' Product Number V-7300 - Vinblastine, Sulfate Salt (Alkaban-AQ, Exal, 29060-LE,...
Cat# V-7300, SKU# V-7300_1g,
1 g, $423.00
Ask
Kai Otsuka, et al.,
bioRxiv - Genomics 2023
Quote:
... containing 2i (1 μM PD0325901, LC Laboratories, MA; and 3 μM CHIR99021, LC Laboratories) and LIF (1,300 U /ml ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Xuesong Li, et al.,
bioRxiv - Cell Biology 2022
Quote:
... MEFs were washed extensively and GFP-booster (tagged with Alexa488, ChromoTek, gb2AF488-50, 1:500 in 3%BSA/PBS) and anti-rabbit-Alexa568 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Ghazal Vahidi, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by Rayon fine cloths and alumina pastes (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm, Ted Pella, Inc.).
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Kolade Adebowale, et al.,
bioRxiv - Cell Biology 2023
Quote:
... different calcium sulfate concentrations were added to a 1 mL Luer lock syringe (Cole-Parmer), to ensure that the initial Young’s modulus is kept constant for fast ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
Sulfate Assay Kit
Cat# DSFT-200,
1.0 kit, 200 tests, USD $319.0
Ask
Yehezqel Elyahu, et al.,
bioRxiv - Immunology 2024
Quote:
... The levels of AST and ALT in murine serum were measured using EnzyChrom™ ELISA kits for AST and ALT (BioAssay Systems) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Samual C. Allgood, et al.,
bioRxiv - Microbiology 2023
Quote:
... glass-bottomed plates (Brooks Life Sciences catalog number MGB096-1-2-LG-L) at 37°C with 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Himanshu Batra, et al.,
bioRxiv - Immunology 2021
Quote:
SEC purified HIV-1 Env-Soc trimers were tested for antigenicity using ELISA involving Microplates pre-coated with Strep-Tactin (IBA Life Sciences GmbH). Microplates were coated with 1 µg/ml SEC-purified gp140-Soc trimers in a volume of 100 µl/well of coating buffer (25 mM Tris-HCl ...
-
Magnetofection
Cat# MF10000,
1 PLATE dimensions 8cm x12cm, USD $488.00/unit
Ask
Olumayokun A Olajide, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and the plate placed on a magnetic plate (OZ Biosciences) and incubated at 37°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Nicolas Massaly, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mice were anesthetized with 1-3% isofluorane and head-fixed in a stereotaxic apparatus (Stoelting). 500 nl of AAV5-CaMKII-ChR2-eYFP (Hope Center Viral Vector Core ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Claudia Matthaeus, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and a secondary Rabbit antibody labelled with 12 nm gold particles (Dianova, 1:30 in 3% BSA/PBS) was applied ...
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).