-
No products found
because this supplier's products are not listed.
Kyra Kerkhofs, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 1% sodium dodecyl sulfate (SDS) and 4X Denhardt’s solution (Bio Basic D0062)] ...
-
No products found
because this supplier's products are not listed.
Clara R. Stelman, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and supplemented with 1:1000 gentamicin sulfate (50mg/ml stock, [Gemini Bio-Products]) throughout the experiment ...
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
Gregory C Loney, Christopher P King, Paul J Meyer,
bioRxiv - Neuroscience 2020
Quote:
... Morphine sulfate (Spectrum Chemicals; New Brunswick, NJ) was dissolved in saline ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Seung-Eon Roh, et al.,
bioRxiv - Neuroscience 2023
Quote:
... CSF Orexin A was detected using a competitive ELISA Kit (Phoenix Pharmaceuticals) (Liguori et al ...
-
No products found
because this supplier's products are not listed.
Abigail E. Powell, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were washed 3X with PBST and blocked overnight at 4 °C with ChonBlock Blocking/Dilution ELISA Buffer (Chondrex). ChonBlock was removed manually and plates were washed 3X with PBST ...
-
No products found
because this supplier's products are not listed.
Samantha L. Wilson, et al.,
bioRxiv - Genomics 2021
Quote:
... Labs 1 and 3 used Antibody 1 (Diagenode, Denville ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Laura Schenkel, et al.,
bioRxiv - Cell Biology 2023
Quote:
... either at the Visitron Spinning Disk (experiments e1 (internal Lab ID: EXP345) and e2 (internal Lab ID: EXP337)) or a Nikon Wide Field microscope (Nikon Ti2-E (inverse), experiments e3 and e4 (internal Lab ID ...
-
No products found
because this supplier's products are not listed.
Jan Becker, et al.,
bioRxiv - Biophysics 2023
Quote:
... a silicon gasket (Grace Bio-Labs CultureWell, 3 × 1 mm; U.S.) was laid on the coverslip to contain the sample ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Mateusz Koselski, et al.,
bioRxiv - Plant Biology 2023
Quote:
... qPCR was performed in 96-well plates using the SensiFastTM SYBR No-ROX Kit (Bioline) in technical triplicates for each biological replicate ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Nina Sillner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cholic acid 7-sulfate (CA-S) and 3’-sialyllactose were purchased from Cayman (Biomol GmbH, Hamburg, Germany). Sulfate (S ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... IL-10 ELISA Kit (Interleukin 10) was purchased from Antibodies-online.com (Limerick ...
-
No products found
because this supplier's products are not listed.
Cecilia Patitucci, et al.,
bioRxiv - Physiology 2023
Quote:
... Sodium Dodecyl Sulfate (SDS, 0.2%; EuroMedex, 1833); Sodium Chloride (NaCl ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Jossana A. Damasco, et al.,
bioRxiv - Biochemistry 2022
Quote:
MC3T3-E1 and 2H11 cells were were purchased from American Type Culture Collection (ATCC, Manasas, VA, USA). MC3T3-E1 cells were cultured in osteoblast-differentiation medium (ODM ...
-
No products found
because this supplier's products are not listed.
Chiann-Ling C. Yeh, et al.,
bioRxiv - Genetics 2021
Quote:
Solid sulfate-limited media (3mg/L ammonium sulfate) was prepared by adding 2% agarose to liquid sulfate-limited media and poured in PlusPlates (Singer Instruments). Solid sulfate abundant media was prepared by adding ammonium sulfate (to 5g/L ...
-
No products found
because this supplier's products are not listed.
He Chen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... A tungsten microelectrode (1–3 MΩ, FHC) was used to record single-neuron activity ...
-
No products found
because this supplier's products are not listed.
Xin Hou, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Plates were incubated with anti-PSY (1 µg.mL-1, Agrisera Antibodies AS163991) or anti-OR (1 µg.mL-1 ...
-
No products found
because this supplier's products are not listed.
Huyen Thi Lam Nguyen, et al.,
bioRxiv - Systems Biology 2022
Quote:
... a MACH 3 Rabbit HRP Polymer Detection kit (Biocare Medical # M3R531H) or a MACH 3 Mouse HRP Polymer Detection kit (Biocare Medical # M3M530H ...
-
No products found
because this supplier's products are not listed.
Matthew P. Ostrowski, et al.,
bioRxiv - Microbiology 2021
Quote:
... Plates were sealed with Breathe-Easy gas permeable sealing membrane for microtiter plates (Diversified Biotech, cat #BEM-1). Microbial growth was measured at least 60 hours by monitoring OD600 using a Synergy HT plate reader (Biotek Instruments ...
-
No products found
because this supplier's products are not listed.
Yongsheng Zheng, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Genomic DNA was extracted from the leaves of T3 transgenic plants (Table S8, lines 1954-1 and 1955-3) using a plant genomic DNA Extraction Kit (Tiangen Biotech, Beijing, China). About 20 μg of DNA was successfully digested with 5 U of EcoRV and incubated at 37 °C for 24 h ...
-
No products found
because this supplier's products are not listed.
Robin Roychaudhuri, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1.5 % Vit B12 and 0.661 g zinc sulfate heptahydrate (Teklad Custom Diet T.110835, Envigo, WI) for 3 months along with age matched control mice that were fed normal chow for the same length of time (Niculescu & Zeisel ...
-
No products found
because this supplier's products are not listed.
Meilin Zhu, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 20% sodium dodecyl sulfate in Tris-EDTA buffer with sterile 0.1 mm glass beads (BioSpec Products #11079101), vigorously rubbed against the walls of the tube to dislodge microbial material ...
-
No products found
because this supplier's products are not listed.
Kyung-Seok Han, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Patch pipettes of 1-3 MΩ resistance pulled from borosilicate capillary glass (Sutter Instrument, Novato, CA) with a Sutter P-97 horizontal puller ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Iuliia Polina, et al.,
bioRxiv - Cell Biology 2023
Quote:
All the protein samples were separated by sodium dodecyl sulfate polyacrylamide (SDS)-PAGE and were transferred to nitrocellulose membrane (Bio-Rad laboratories, Genesee Scientific ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Seishiro Hirano, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ML792 (SUMO E1 inhibitor) and TAK243 (ubiquitin E1 inhibitor) were purchased from MedKoo Bioscience (Morrisville, NC) and Selleckchem (Houston ...
-
No products found
because this supplier's products are not listed.
Chao Liu, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Ang-(1-7) concentration was measured using ELISA kit (S-1330, Bachem, CA, USA)
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sara F. Costa, et al.,
bioRxiv - Microbiology 2023
Quote:
... One microliter of each sample was mounted on a layer of 1.2% (w/v) agarose in 1:3 (vol/vol) TSB/PBS placed on a glass plate (Bio-Rad Mini-PROTEAN Short Plate) with a coverslip placed on top of each sample ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Hassan E. Eldesouky, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gentamicin sulfate was purchased from Chem-Impex International INC ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Hyunji Kang, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... fabricated from a borosilicate glass capillary (1–3 MΩ, GC100T-10, Harvard Apparatus, USA), was placed in stratum radiatum of hippocampal CA1 ...
-
No products found
because this supplier's products are not listed.
Mark S. Moehle, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... transferred to daughter plates using an Echo acoustic plate reformatter (Labcyte, Sunnyvale, CA) and diluted in Assay Buffer to a 2X final concentration ...