-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Armin Bayati, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was then conjugated with 5 nm gold beads (Cytodiagnostics, cat# CGN5K-5-2), immediately before experimental use ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Ke Hou, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with a R-AXIS HTC imaging plate detector (Rigaku). Cu K-α x-ray beam with 1.5406 Å wavelength was used ...
-
No products found
because this supplier's products are not listed.
Avanti Gokhale, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 3 1-minute washes) on a mini-100 orbital genie (Scientific Industries) at room temperature ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 CaCl2, 30 D-glucose) equilibrated with carbogen (95% O2, 5% CO2) by a peristaltic pump (Dynamax RP-1, Rainin Instrument Co; Emeryville CA, USA). As previously published (figure 6a (Huff et al. ...
-
No products found
because this supplier's products are not listed.
Carolin Berwanger, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Resuspended cells were homogenised in a 5 mL Dounce homogeniser (Wheaton Type B) by ten quick strokes of a tight-fitting puncher avoiding foam formation ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The following antigens were coated on separate 384-well ELISA plates: anti-Fd antibody (The Binding Site GmbH) 1:1000 in PBS ...
-
No products found
because this supplier's products are not listed.
Wenjie Wang, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The P12Y oligonucleotide linked to tyrosine at the 3’-end (5’-HO-GAAAAAAGAGTT-PO4-Tyr-3’, TopoGEN) was labeled at the 5’-end with 32P ...
-
No products found
because this supplier's products are not listed.
Steven J. Grzegorski, et al.,
bioRxiv - Genetics 2019
Quote:
... Prothrombin levels in the expression media and the cell lysate were then quantified by ELISA using a matched-pair antibody set ELISA kit (Affinity Biologicals Inc.; FII-EIA).
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Swayam Prakash Srivastava, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Urine albumin levels were assayed using a Mouse Albumin ELISA Kit (Exocell, Philadelphia, PA).
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Pavel A. Nikitin, et al.,
bioRxiv - Immunology 2022
Quote:
... Plates were washed 3 times with endotoxin-free GVB buffer with Ca2+ and Mg2+ (GVB++, Complement Technology) and incubated with normal human serum (Complement Technology ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Salman Sohrabi, Vanessa Cota, Coleen T. Murphy,
bioRxiv - Bioengineering 2023
Quote:
Molds for layer #3 and layer #5 (Figure S1d) are fabricated using SU-8 2075 (MicroChem, Newton, MA, USA) spin-coated at 2150rpm for 30s to create ∼100μm tall patterns (Figure S2a ...
-
No products found
because this supplier's products are not listed.
Seung Woo Ryu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... An MRE11-specific shRNA (5’ACAGGAGAAGAGAUCAACUUUGuuaauauucauagCAAAGUUGAUCUCUUCUCCUGU-3’) was expressed under doxycyclin control from pRSITEP-U6Tet-(sh)-EF1-TetRep-2A-Puro (Cellecta, Inc.). BacMam constructs were generated from pAceBac1 (Geneva Biotech ...
-
No products found
because this supplier's products are not listed.
Hongkui Xiao, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were read for absorbance at 405 nm (TriStar plate reader). Resulting data were plotted as concentration (x axis ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Michael G. LaMontagne, et al.,
bioRxiv - Microbiology 2022
Quote:
... Temperature and dissolved oxygen were measured in situ at 3 – 5 cm beneath the surface with a YSI model 55 dissolved oxygen (DO) probe (YSI Inc., Young Spring, OH). Water samples were split in the field for FIB (E ...
-
No products found
because this supplier's products are not listed.
Tayler D. Sheahan, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3 µM (Adooq Bioscience A18250); oxytocin ...
-
No products found
because this supplier's products are not listed.
Hai Li, et al.,
bioRxiv - Biophysics 2021
Quote:
... and IMISX™ plates (MiTeGen) which are designed to perform in meso in situ serial X-ray crystallography (Huang et al. ...
-
No products found
because this supplier's products are not listed.
Thomas T. Thomsen, et al.,
bioRxiv - Microbiology 2021
Quote:
... from which 20 μl was spotted on solid lactose agar plates (Bromthymole Blue plates, SSI Diagnostica). Bacterial counts were recorded after overnight incubation at 37°C in ambient air ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... The 384-well source plate (Scienion) was kept at dewpoint ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Minh Dao Ngo, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 mL aminopropyl SPE columns (Biotage; Charlotte, NC). The samples were dissolved in 1 ml of hexane and transferred to the SPE column ...
-
No products found
because this supplier's products are not listed.
Rachel Grazda, et al.,
bioRxiv - Immunology 2023
Quote:
200μL fluorescent Dil (DilC18(3))-labeled liposomes (Liposoma) were administered to mice via retro-orbital I.V ...
-
No products found
because this supplier's products are not listed.
Diana Cortes-Selva, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were coated with 2μg/mL tetanus (List Labs), diphtheria (Sigma) ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Kellie A. Cotter, et al.,
bioRxiv - Genomics 2022
Quote:
... to reduce uncapped RNAs to 5′ hydroxyls and make them incapable of ligating to 5′ adaptor and Cap-Clip (catalog no. C-CC15011H; Cambio) to remove the 5′ cap of transcripts that had undergone guanylation and allow them to be incorporated into the library through 5′ adapter ligation ...
-
No products found
because this supplier's products are not listed.
Rebecca O’Cleirigh, Roslyn Gibbs,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... containing 5% (v/v) FCS and incubated overnight in a humidified atmosphere at 37°C and 5% CO2 (Nuaire, DH Autoflow). After 24 hours 1.5mL of the media was removed and media with herb extract or media only control was added ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...
-
No products found
because this supplier's products are not listed.
M. Martinez, et al.,
bioRxiv - Microbiology 2023
Quote:
... at 4°C and loaded 3 times in a CellD disrupter (Constant Systems). The lysate was centrifuged for 15min at 12000 x g at 4°C to remove cell debris and the supernatant was centrifuged again for 1h at 100000 x g at 4°C ...
-
No products found
because this supplier's products are not listed.
Nour Muinis Ramadan, et al.,
bioRxiv - Immunology 2020
Quote:
... supplemented with 5% of sheep blood (LAMPIRE biological laboratories, PA) and incubated anaerobically with CO2 anaerobic pack (AnaeroPack® System ...
-
No products found
because this supplier's products are not listed.
Bert van de Kooij, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the test plate was washed twice with PBS and DirectPCR lysis reagent (Viagen) mixed 1:1 (vol ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Mengdi Yang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... qRT-PCR was performed in 96-well plates format using FastSYBR Low Rox (CoWin Biosciences) on Quantstudio 3 Real-Time PCR System (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Alexandra A. Silverman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... the cells were incubated for 3 hours and then imaged with a coverglass lid (Bioptechs, 4200312) using a Nikon ECLIPSE TE2000-E inverted microscope ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...