-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Akhil A. Vinithakumari, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and p-cresol sulfate (pCS) and p-cresol glucuronide (pCG) were purchased from United States Biological, (Salem ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, et al.,
bioRxiv - Immunology 2021
Quote:
The triphosphorylated RNA oligonucleotides SLR-14 (5′ pppGGAUCGAUCGAUCGUUCGCGAUCGAUCGAUCC-3′ and SLR-14-amino (5′ pppGGAUCGAUCGAUCGUXCGCGAUCGAUCGAUCC-3′ where X = aminomodifier C6dT; Glen Research) were prepared as described57 ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... which were diluted 1:100 in triplicate into 5 mL fresh CHG media containing either 100 μM of the corresponding substrate (either LCA [Sigma] or 3-oxoLCA [Steraloids]). Cultures were grown for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Mark S. Lee, et al.,
bioRxiv - Immunology 2023
Quote:
... 5×104 transduced 58α-β- T cell hybridomas were cocultured with 1×105 transduced I-Ek+ M12 cells in triplicate in a 96 well round bottom plate in RPMI with 5% FBS (Omega Scientific), Pen-Strep+L- Glutamine (Cytiva) ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Anitha Shenoy, et al.,
bioRxiv - Cell Biology 2022
Quote:
Collagen staining was performed on 5 μm thick sections of 4% PFA fixed paraffin-embedded lung lobes using Picro-Sirius Red Stain Kit from ScyTek Laboratories Inc ...
-
No products found
because this supplier's products are not listed.
Itamar Harel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... equipped with 3 emCCDs (Evolve, Photometrics Inc.) using an Olympus UPlanApo 100x (NA 1.40 ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Prashant P. Damke, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 5% FBS (Cell Biologics H6621) in collagen-coated cell culture flasks at 5% CO2 and 37°C ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Yuanjun Shen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Softwell hydrogel-coated plates were purchased from Matrigen (Brea, CA) and used following the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
MR Melo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats were transferred to a stereotaxic frame (incisor bar +3 mm; RWD Life Science). To perform the optogenetic experiments ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Simon Schäper, et al.,
bioRxiv - Microbiology 2023
Quote:
... 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-Gal, Apollo Scientific) was used at 100 μg/ml ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Julian G. Dishart, et al.,
bioRxiv - Neuroscience 2023
Quote:
... L4 populations were washed off plates in M9 and seeded onto pre-treated (+)-5-Fluorodeoxyuridine (FUDR; Spectrum Chemical) OP50 plates ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Cecilia S. Blengini, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Internal control Reverse: 5’ - GTAGGTGGA AATTCTAGCATCATC C- 3’) were used at 20 pMol using FastMix French PCR beads (Bulldog Bio, #25401) following manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Victoria Zyulina, et al.,
bioRxiv - Immunology 2020
Quote:
... For direct LC differentiation CD34+ cells were cultured for 7 days in a 24 well tissue culture plate (5×104 cells per well) in serum free CellGro DC medium (CellGenix, Freiburg, Germany) supplemented with Glutamax ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Xing Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 x 10-5 M DL-AP5 (DL-2-amino-5-phosphonopentanoic acid, BN0086, Biotrend), and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Jing Zhou, et al.,
bioRxiv - Neuroscience 2023
Quote:
... A 5 × 5-cm white compressed cotton pad (Nestlets, Ancare) was placed in the center of the cage ...
-
No products found
because this supplier's products are not listed.
Pragya D. Yadav, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were blocked with a Liquid Plate Sealer (CANDOR Bioscience GmbH, Germany)/ Stabilcoat (Surmodics) for two hours at 37°C ...
-
No products found
because this supplier's products are not listed.
Qin Li, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Cells were seeded into 96-well culture plates at the density of 3000 cells per well after transfected with siRNA oligos and cultured for 5 days with the viability measured daily using the Cell Counting Kit-8 (CCK8) (TargetMol) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Ved Mehta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Precipitated sodium deoxycholate was removed by filtering through a Corning® 2 µM PVDF plate and samples were further desalted on a 96-well MacroSpin plate (The Nest Group). Peptides were eluted with 80% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Cassandre Bedu-Ferrari, et al.,
bioRxiv - Microbiology 2024
Quote:
... 5% H2 atmosphere (Coy Lab Products, USA) (Text S1) ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Adil Mohamed, et al.,
bioRxiv - Microbiology 2019
Quote:
... and analysis with FSC Express 5 (De Novo Software). Identical gates were applied to all samples of a given experiment ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...