-
No products found
because this supplier's products are not listed.
Riki Kawamura, Masato Nikaido,
bioRxiv - Neuroscience 2022
Quote:
... dehydroepiandrosterone 3-sulfate (DHEA-s), β-estradiol 17-(β-D-glucuronide) (E2-17g), and β-estradiol 3,17-disulfate (E2-3, 17s) were respectively purchased from Tokyo Chemical Industry, Cayman Chemical Co. ...
-
No products found
because this supplier's products are not listed.
Eziwoma Alibo, et al.,
bioRxiv - Immunology 2021
Quote:
... Jedi T cells were activated for 3 days with 5 mg/ml plate-bound anti-CD3 mAb (clone 2C11, BioXCell), 1 mg/ml anti-CD28 mAb (clone 37.51 ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Rukesh Chinthapatla, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Cytidine 5’-O-(1-thiotriphosphate) and 3’-deoxycytidine 5’-triphosphate were from TriLink. Adenosine 5’-O-(1-thiotriphosphate ...
-
No products found
because this supplier's products are not listed.
Annelot C. M. van Esbroeck, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... After rinsing the membrane with TBS-T (3 × 5 min) and TBS (3 × 5 min) fluorescence was detected by scanning on the Odyssey CLx (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Alex Y. Ge, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Cells were harvested on day 5 and the proportion of apoptotic cells was assessed using the NucView 488 Caspase-3 Assay Kit (Biotium) according to the manufacturer’s instructions and an Attune NxT flow cytometer (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Yesica R Frontini-Lopez, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5 mM MgCl2 reaction buffer containing 0.015% w/v 5-bromo-4-chloro-3-indolyl phosphate-BCIP-(Calbiochem) substrate and 0.03% w/v nitro blue tetrazolium-NBT-(BDH Chemicals Ltd. ...
-
No products found
because this supplier's products are not listed.
Max D. Knickmeyer, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Embryos were examined at 3-5 dpf using a stereomicroscope (Nikon SMZ18) with a light source for fluorescence ...
-
No products found
because this supplier's products are not listed.
Yasmin Fareed, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... the following reference glucuronide and sulfate conjugates were obtained from Toronto Research Chemicals (Toronto, Canada): quercetin-7-O-β-D-glucuronide ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Melody Li, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Patch pipettes of 3-5 MΩ (Harvard Apparatus) were made using a puller (P-1000 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Radvanyi, et al.,
bioRxiv - Physiology 2023
Quote:
... Commercial ELISA kits were employed to measure cFGF23 (Quidel, Cat. #60-6100) and iFGF23 (Quidel ...
-
No products found
because this supplier's products are not listed.
Rebecca A. MacPherson, et al.,
bioRxiv - Genomics 2022
Quote:
... We used 2μL of the resulting DNA mixture in a PCR reaction with primers (Left: 5’-CTAGCACGGAACCCTGGAAAT -3’; Right: 5’-GCAGCGCCTAGTAATCACAGA -3’) according to ApexRedTaq (Genesee Scientific, El Cajon, CA) manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Andrew B. Stergachis, et al.,
bioRxiv - Genetics 2023
Quote:
... which preserves 3’ and 5’ end information (PacBio, Menlo Park, CA). A PacBio SMRTbell library was constructed using these PCR-amplified full-length cDNA transcripts and sequenced using a Sequel II ...
-
No products found
because this supplier's products are not listed.
Adeel Ahmed, et al.,
bioRxiv - Bioengineering 2020
Quote:
... ports 3 and 5 were sealed using adhesive tape (Scotch brand, 3M, USA), and a second collagen solution (COL1 ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Po-Hsiang Wang, et al.,
bioRxiv - Microbiology 2019
Quote:
[3,4C-13C]estrone (99%) was purchased from Cambridge Isotope Laboratories (Tewksbury ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
Cat# HY-B0234-5 g,
5 g, USD $102.0
Ask
Shuangshuo Jia, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and the autophagy inhibitor 3-methyladenine (3-MA; 5 mM; MedChemExpress) were applied to validate their respective effects.
-
No products found
because this supplier's products are not listed.
Heather J. Faust, et al.,
bioRxiv - Cell Biology 2023
Quote:
... ELISA detection of aldosterone was performed using the Aldosterone ELISA Assay Kit from Eagle biosciences (ALD31-K01) according to manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Takuma Hayashi, Motoki Ichikawa, Ikuo Konishi,
bioRxiv - Immunology 2022
Quote:
... cTnT ELISA: Serum cTnT levels were determined with mouse cTnT ELISA Kit (CUSABIO TECHNOLOGY LLC, Houston, TX, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits were used to measure estrogen (Calbiotech ES180S-100), progesterone (IBL America ...
-
No products found
because this supplier's products are not listed.
Thorsten M. Leucker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA (IDEXX) and HI assays were performed on serum from contact pigs at 17 dpc to determine if IAV-specific antibodies were present to indicate virus transmission.
-
No products found
because this supplier's products are not listed.
Michael Westberg, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Sitting drops were dispensed on Intelli-plates 96-3 LVR (Hampton Research) using an Oryx8 crystallization robot (Douglas Instruments) ...
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
Nicholas A. Pudlo, et al.,
bioRxiv - Microbiology 2020
Quote:
... 5 mice were switched to a diet containing 3% Porphyrayezoensis (TD.190608, Envigo), which was ground into a course powder and added to TD.190608 to replace 3% of the dextrose contained in the base diet ...
-
No products found
because this supplier's products are not listed.
Alexander P Bye, et al.,
bioRxiv - Immunology 2021
Quote:
... by shaking at 1200 rpm for 5 minutes at 37°C using a plate shaker (Quantifoil Instruments) after stimulating with collagen at a range of concentrations ...
-
No products found
because this supplier's products are not listed.
Grigoria Spanou, et al.,
bioRxiv - Microbiology 2023
Quote:
... coli was grown on Chromogenic Tryptone Bile X-glucuronide (TBX) Agar (Neogen. USA) at 37°C for 24h ...
-
No products found
because this supplier's products are not listed.
Michael Fairhead, et al.,
bioRxiv - Biochemistry 2019
Quote:
... in Swissci 3 well sitting drop plates (Molecular Dimensions). Crystals appeared in several conditions over 4-7 days ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Zilong Wang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... followed by filtration with 3 MWCO 96-well plate (Pall Corporation, Port Washington, NY). Kinetex XB-C18 ...
-
No products found
because this supplier's products are not listed.
Rebecca J. Edgar, et al.,
bioRxiv - Microbiology 2019
Quote:
... 32 using the AmpliteTM Fluorimetric sn-Glycerol-3-Phosphate (Gro-3-P) Assay Kit (AAT Bioquest). GAC was released from cell wall by sequential digestion with mutanolysin hydrolase and PlyC amidase ...
-
No products found
because this supplier's products are not listed.
M. Kawai, M. Nie, H. Oda, S. Takeuchi,
bioRxiv - Bioengineering 2024
Quote:
... Keratinocyte Growth Medium 3 Kit was purchased from PromoCell GmbH (Heidelberg ...
-
No products found
because this supplier's products are not listed.
Yoichi Araki, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or Spinning disk confocal microscopes controlled by axiovision software (Carl Zeiss; Fig. 2, 3, and 5). Following 5-10 min of baseline recording ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
Estrone (E1) ELISA Kit is an ELISA Kit for the in vitro quantitative measurement of Estrone (E1)...
Cat# abx150343-5×96T,
5 × 96 tests USD $3929.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jérémy Dufloo, et al.,
bioRxiv - Microbiology 2024
Quote:
... Correct insertion was checked by colony PCR using vector-specific primers (Forward: 5’-GAGAACCCACTGCTTACTGGC-3’; Reverse: 5’-AGGGTCAAGGAAGGCACG-3’) and the NZYTaq II 2x Green Master Mix (NZYtech). Plasmids with correct insertions were checked by Sanger (Eurofins ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
Estrone is an estrogenic hormone.
Cat# S1665, SKU# S1665-50mg,
50mg, $97.00
Ask
Satyaki Sengupta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
5 x105 SH-SY5Y cells were seeded into 10 cm plates and treated with either 5 µM EED226 (Selleck Chemicals) or DMSO (vehicle control ...
-
No products found
because this supplier's products are not listed.
Hongwen Chen, et al.,
bioRxiv - Biophysics 2023
Quote:
... and the complex was eluted with 5 CVs of 3×Flag peptide (0.1 mg/ml; ApexBio). The eluted protein was further purified by gel filtration using a Superose 6 Increase 10/300 GL column (Cytiva ...
-
No products found
because this supplier's products are not listed.
Ghazal Vahidi, et al.,
bioRxiv - Physiology 2023
Quote:
... followed by Rayon fine cloths and alumina pastes (9, 5, 3, 1, 0.5, 0.3, and 0.05 μm, Ted Pella, Inc.).