-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Subhrangshu Guhathakurta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from days 1-6 and 3-μM CHIR99021(Reprocell, 04-0004) from days 3-12 ...
-
No products found
because this supplier's products are not listed.
Divine C. Nwafor, et al.,
bioRxiv - Neuroscience 2021
Quote:
... D3 cells were seeded onto 3 independent collagen-coated 16-well E-Plate PET arrays (ACEA Biosciences, San Diego, CA) at a concentration of 20,000 cells/well and loaded onto an xCelligence RTCA DP system (ACEA Biosciences ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Rafael D. González-Cruz, et al.,
bioRxiv - Bioengineering 2023
Quote:
... transferred to a 24-well polystyrene plate (see Fig. 1(c)) (CELLTREAT), and equilibrated with complete cortical media for 48 hours at 37°C prior to cell seeding ...
-
No products found
because this supplier's products are not listed.
Himanshu Batra, et al.,
bioRxiv - Immunology 2021
Quote:
SEC purified HIV-1 Env-Soc trimers were tested for antigenicity using ELISA involving Microplates pre-coated with Strep-Tactin (IBA Life Sciences GmbH). Microplates were coated with 1 µg/ml SEC-purified gp140-Soc trimers in a volume of 100 µl/well of coating buffer (25 mM Tris-HCl ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Ling Bai, et al.,
bioRxiv - Physiology 2021
Quote:
... Exendin-3 (ApexBio, B6943) 10 ug/mouse in saline.
-
No products found
because this supplier's products are not listed.
Alexis Bénard, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... whose DNA was extracted using the EZ-10 96-well Plate Animal Genomic DNA® kit (Bio Basic). In brief ...
-
No products found
because this supplier's products are not listed.
Angela Rubio, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A total of 100 ng was used as input for the NEXTFLEX Small RNA Sequencing Kit (Version 3; Bioo Scientific), and libraries were generated following the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Zachary T. Olmsted, et al.,
bioRxiv - Neuroscience 2020
Quote:
... hiPSCs were seeded onto freshly coated 6-well plates 3 days prior to transduction with premade LV-CAG-eGFP lentivirus (Kerafast FCT149, 1 × 108 CFU/ml). Polybrene (2 μg/ml ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Katelyn H. McKown, et al.,
bioRxiv - Plant Biology 2022
Quote:
... stratified on ½ MS plates (Caisson labs, 1% Agar, pH 5.7) for 4-6 days at 4°C and transferred to a growth chamber set to long day conditions (16 h/8 h light/dark ...
-
No products found
because this supplier's products are not listed.
A.J. Middleton, et al.,
bioRxiv - Biochemistry 2021
Quote:
... at 200:200 nL and 200:100 nL protein:well solution drop ratios in Swissci 3-well sitting drop plates using a mosquito (TTP Labtech). Diffraction-quality crystals of the UbV.k.2-Ube2k complex were produced in 0.2 M sodium citrate tribasic trihydrate ...
-
No products found
because this supplier's products are not listed.
Marieke G. Verhagen, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... pCAG-Sema6a-GFP or pCAG-Sema6aΔcyt-GFP constructs in 1:3 PEI 1 mg/ml (Polyscience) in H2O ...
-
No products found
because this supplier's products are not listed.
Eric M. Mulhall, et al.,
bioRxiv - Biophysics 2019
Quote:
Silica microspheres (200 μL of 1% w/v, 3 μM; Bangs Laboratories) were cleaned and hydroxylated by first washing them in a glass tube in MilliQ water ...
-
No products found
because this supplier's products are not listed.
Eva Morgenstern, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 50mM NH4HCO3/acetonitrile (3/1) and 50mM NH4HCO3/acetonitrile (1/1) while shaking gently in an orbital shaker (VXR basic Vibrax, IKA). Gel pieces were lyophilized after shrinking by 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Kai Otsuka, et al.,
bioRxiv - Genomics 2023
Quote:
... containing 2i (1 μM PD0325901, LC Laboratories, MA; and 3 μM CHIR99021, LC Laboratories) and LIF (1,300 U /ml ...
-
No products found
because this supplier's products are not listed.
Nicolas Massaly, et al.,
bioRxiv - Neuroscience 2022
Quote:
Mice were anesthetized with 1-3% isofluorane and head-fixed in a stereotaxic apparatus (Stoelting). 500 nl of AAV5-CaMKII-ChR2-eYFP (Hope Center Viral Vector Core ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Simonas Juzenas, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The 3’-amino modified oligos (Supplementary Table S5) were activated by 1 mM NHS-methyltetrazine (Click Chemistry Tools) in 50% DMSO for 60 min at 21 °C ...
-
No products found
because this supplier's products are not listed.
Katja Baur, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the tissue was incubated in a well of a 24-well-plate containing 1 ml Euromed-N (Euroclone) with 1x B27 supplement (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Matthieu Fritz, et al.,
bioRxiv - Microbiology 2023
Quote:
... and amplicons approximately 2–3 kb in size were excised from the gel and purified using the Quick-spin PCR Product Purification Kit (iNtRON Biotechnology, Korea). The amplicons were further cloned in pJET1.2 cloning plasmid (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Celia Fernandez-Sanz, et al.,
bioRxiv - Physiology 2021
Quote:
... Nanogold particles were developed for 3 min using GoldEnhance™ (Nanoprobes). Gold enhancement was followed by fixation with 1.6% glutaraldehyde and 0.2% tannic acid in PBS ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Ambre Guillory, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and homogenized in GUS extraction buffer before 1 µg of total protein extracts were used for enzymatic reactions at 37°C using 1 mM of the 4-MUG substrate (4-Methylumbelliferyl-β-D-glucuronide hydrate, Biosynth M-5700). GUS activity was measured using a FLUOstar Omega 96 microplate reader (BMG LABTECH ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 4-[(2S)-2-[(5-isoquinolinylsulfonyl)methylamino]-3-oxo-3-(4-phenyl-1-piperazinyl)propyl] phenyl isoquinolinesulfonic acid ester (KN-62; Tocris and HelloBio); D-AP5 (HelloBio) ...
-
No products found
because this supplier's products are not listed.
Aereas Aung, et al.,
bioRxiv - Immunology 2021
Quote:
... Fresh 1 mg/mL stock solutions of Sulfo-Cyanine 3 (21320, Lumiprobe) and -Cyanine 5 (23320 ...
-
No products found
because this supplier's products are not listed.
Pauline M.L. Coulon, et al.,
bioRxiv - Microbiology 2020
Quote:
... genomic DNA was extracted using a 96-wells plate gDNA extraction kit (Favorgen, Canada).
-
No products found
because this supplier's products are not listed.
Jennifer A. Rinker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Mice were deeply anesthetized with vaporized isoflurane (1-3%, SomnoSuite Vaporizer, Kent Scientific) and 200 nl of AAV1-CaMKII-GCaMP6f (Addgene ...
-
No products found
because this supplier's products are not listed.
Oghenerukevwe Akpoghiran, et al.,
bioRxiv - Neuroscience 2023
Quote:
... We employed 100 µL of 1-Bromo-3-Chloropropane (Molecular Research Center, Inc.) to separate the phases ...
-
No products found
because this supplier's products are not listed.
Jason Z. Chen, et al.,
bioRxiv - Microbiology 2023
Quote:
... Individual colonies from each plate were inoculated into 3 mL of LB media and incubated in a shaking incubator (New Brunswick Scientific Excella E25) at 30°C for 12 hours with shaking at 225 rpm ...
-
No products found
because this supplier's products are not listed.
Renee J. Tamming, et al.,
bioRxiv - Neuroscience 2019
Quote:
Brains from 3-month-old mice were stained using the FD Rapid GolgiStain Kit (FD Neurotechnologies, Inc). They were then flash frozen and sectioned on a cryostat at 100µm thickness and further processed as per kit instructions ...
-
The Bimake Cell Counting Kit-8 (CCK-8) is a fluorescent assay for the determination of cell...
Cat# B34304, SKU# B34304-25 mL (2500 rxns),
25 mL (2500 rxns), $201.00
Ask
Farshad Farshidfar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... seeded in 96-well plates (2×103/well, five replicates) and cell viability was measured with Cell Counting Kit-8 (CCK-8) (Bimake.com, China). The CCK-8 test was repeated every 24 hrs for three days.
-
No products found
because this supplier's products are not listed.
Valérie Clavet-Fournier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The ACSF solution was continuously infused with 5 % CO2 and delivered with a flow of ∼1 ml/min (MINIPULS 3 Peristaltic Pump, Gilson).
-
No products found
because this supplier's products are not listed.
Brandon S. Johnson, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and a 3 hr Solusol (National Diagnostics) digestion to dissolve the cell wall fraction ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Mireia Andreu-Carbó, et al.,
bioRxiv - Cell Biology 2021
Quote:
... washed three times with TBS-Tween 1 % solution and revealed with an ECL Western blotting detection kit (Advansta) and with Fusion Solo Vilber Lourmat camera (Witec ag).