-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... Monkey IFN-gamma ELISA Kit (U-CyTech biosciences), and Monkey IL-17 ELISA Kit (U-CyTech biosciences) ...
-
No products found
because this supplier's products are not listed.
Natalia Varela-Andrés, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and bovine serum albumin 5% (BSA, MB04602; NZYtech) in PBS ...
-
No products found
because this supplier's products are not listed.
Suzanne M. Scheaffer, et al.,
bioRxiv - Microbiology 2022
Quote:
... Serum samples were serially diluted in 5% bovine serum albumin in TBS (Boston BioProducts, Cat. # IBB-187), added to plates ...
-
No products found
because this supplier's products are not listed.
Yasuhiro Shishikura, et al.,
bioRxiv - Physiology 2021
Quote:
Serum cfDNA (500 μL) was extracted using Serum Cell-Free Circulating DNA Purification Mini Kits (Norgen Biotek Corp.). Urinary cfDNA (10 mL ...
-
Estradiol (17β-estradiol, β-Estradiol, E2, 17β-Oestradiol) is a human sex hormone and steroid,...
Cat# S1709, SKU# S1709-50mg,
50mg, $97.00
Ask
Satyaki Sengupta, et al.,
bioRxiv - Cancer Biology 2021
Quote:
5 x105 SH-SY5Y cells were seeded into 10 cm plates and treated with either 5 µM EED226 (Selleck Chemicals) or DMSO (vehicle control ...
-
No products found
because this supplier's products are not listed.
Nikolaos Panagiotou, et al.,
bioRxiv - Cell Biology 2022
Quote:
Wound healing and uraemic serum assays were performed in E-Plate VIEW 96 (ACEA Biosciences, Inc., USA), which is a specific type of 96-well plate ...
-
No products found
because this supplier's products are not listed.
Jirina Zackova Suchanova, et al.,
bioRxiv - Plant Biology 2023
Quote:
... then 5×106 cells were plated on ESAW agar plates containing 450 μg mL-1 nourseothricin (Jena Bioscience), and incubated in constant light at 18 °C.
-
No products found
because this supplier's products are not listed.
Manmeet Bhalla, et al.,
bioRxiv - Microbiology 2021
Quote:
... Bacterial titers were confirmed by plating on tryptic soy agar plates supplemented with 5% sheep blood agar (Hardy Diagnostics).
-
No products found
because this supplier's products are not listed.
Michael Ronzetti, et al.,
bioRxiv - Biochemistry 2022
Quote:
The DSF assay plate was constructed by dry-spotting 5 nL of SYPRO Orange with an acoustic dispenser (Echo 555, Labcyte) into a 384-well PCR plate ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Christopher Marra, et al.,
bioRxiv - Neuroscience 2023
Quote:
DRG neurons grown on coverslips as described above were first treated with a blocking solution consisting of sterile HBSS with 10 mM HEPES + 1% horse serum for 5 minutes at room temperature followed by staining with HBSS/HEPES + 70 mM Di-8-ANEPPS (Biotium, Fremont, CA) for 15 minutes room temperature and recovery in HBSS/HEPES + 10% horse serum for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Jeroen Corver, et al.,
bioRxiv - Microbiology 2024
Quote:
... the serum was yielded (Eurogentec).
-
No products found
because this supplier's products are not listed.
Julia A Alvarez, et al.,
bioRxiv - Microbiology 2024
Quote:
... 100 or 300 tachyzoites were plated in HFF monolayers grown in a 24-well plate and 4-6 days later were counted by microscopy (4x objective) (Nikon Eclipse Ti-5).
-
No products found
because this supplier's products are not listed.
Sebastien Riquier, et al.,
bioRxiv - Genomics 2020
Quote:
... 0.5 % Ultroser G serum substitute (PALL life sciences) and 50 µg/ml Gentamicin (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Josefa Cruz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... ELISA was performed according to the manufacturer’s instructions using a commercial ELISA kit (Bertin Bioreagents) that detects ecdysone and 20- hydroxyecdysone with the same affinity ...
-
No products found
because this supplier's products are not listed.
Ellen G. Wall, et al.,
bioRxiv - Physiology 2023
Quote:
... of plasma together with standards (estradiol, Cerillant; testosterone, National Measurement Institute (NMI)) and quality control samples were fortified with deuterated d4-estradiol (Cambridge Isotope Lab) and d3-testosterone (NMI ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Skylar J. Ferrara, et al.,
bioRxiv - Immunology 2021
Quote:
... Quantification of TREM2 concentration via ELISA was performed using a TREM2 ELISA kit (Reddot Biotech Inc). following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Yubao Fan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or 5% donkey serum (Abbkine, Wuhan, CN.) for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Rufaida Wasim, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... AGE levels were measured in homogenates and serum using an ELISA kit designed specifically for use with rats (ABIN368041, antibodies-online GmbH, Aachen, Germany) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Pati Moloko Maindo, et al.,
bioRxiv - Microbiology 2019
Quote:
Serum samples were routinely screened for HBsAg using ELISA (Hepanostika® HBs, Biomérieux, France and Abbott GmbH & Co. KG, Wiesbaden, Germany), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Brian V. Tsu, et al.,
bioRxiv - Microbiology 2020
Quote:
... Membranes were blocked with PBS-T containing 5% bovine serum albumin (BSA) (Spectrum, New Brunswick, NJ), followed by incubation with primary antibodies for V5 (IL-1β) ...
-
No products found
because this supplier's products are not listed.
Zhongzhen Liu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Serum/Plasma Circulating DNA Kit (TIANGEN, Cat. No.: DP339, TG for short), or from 1 mL plasma using QIAamp Circulating Nucleic Acid Kit (QIAGEN ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
Alexandria J. Hammond, et al.,
bioRxiv - Microbiology 2020
Quote:
... and Type 23F serum (Statens Serum Institut, 16913) antibody (1:200 in 0.5% FBS-PBS ...
-
No products found
because this supplier's products are not listed.
C. Sahara Khademullah, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Human and mouse Plasma and CSF samples were probed for KCC2 in a mouse SLC12A5 Sandwich ELISA kit (Cedarlane, LS-F65788).
-
No products found
because this supplier's products are not listed.
Kristen W. Cohen, et al.,
bioRxiv - Immunology 2021
Quote:
Samples were single-cell sorted into 96-well PCR plates containing 5 µL of DNA Suspension Buffer (Teknova) with 1% BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Yini Zhu, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Cells were seeded at 5×105 cells in 200μl serum-free DMEM in the upper chamber of the inserts (Celltreat, 230639). DMSO or imatinib (4µM ...
-
No products found
because this supplier's products are not listed.
Valery Adorno-Cruz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Cells were plated at a low density of 1,000 cells in suspension in a 6-well plate covered with poly-HEMA in PRIME-XV® Tumorsphere serum-free medium (Irvine scientific, 91130). 8 days after plating a total number of spheres (diameter >50 µm ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Agnieszka Szmitkowska, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and grown on vertically oriented plates for five more days prior to imaging with the Axiolab 5 (Carl Zeiss Microscopy, GmbH). To determine the AHK5-dependent ethylene effect on the root cap ...
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
... black walled 96-well plates (0.5-1.5×104 cells/well) and Cell Navigator™ Lysosome Staining Kit (AAT Bioquest) was used according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The working plate (96-well plate) was used as a source plate for robotic spotting using a ROTOR HDA benchtop robot (Singer Instruments, United Kingdom) on rectangular OmniTray plates (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
David M. Zong, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... An aluminium plate seal (Diversified Biotech) was applied and the plate was frozen at -20 °C.
-
No products found
because this supplier's products are not listed.
Zhaotong Cong, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... were grown in ESF 921 serum-free medium (Expression Systems) at 27°C and 120 rpm ...
-
No products found
because this supplier's products are not listed.
Simona Miron, et al.,
bioRxiv - Biochemistry 2023
Quote:
... washed (5 × 5 min PBS-T) and scanned using Odyssey CLx imaging system (LI-COR).
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Heather Schiller, et al.,
bioRxiv - Microbiology 2023
Quote:
... Pop-out transformants were selected on agar plates containing 5-fluoroorotic acid (FOA) (Toronto Research Chemicals Inc.) at a final concentration of 50 μg mL-1 ...
-
No products found
because this supplier's products are not listed.
Kiryl D. Piatkevich, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Five voltage pulses (50 V, 50 ms duration, 1 Hz) were delivered using 5 mm round plate electrodes (ECM™ 830 electroporator, Harvard Apparatus), placing anode or cathode on the top of the skull to target cortex or hippocampus ...
-
No products found
because this supplier's products are not listed.
Maikke B. Ohlson, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-EU was labeled in permeabilized cells using the Click & Go Kit (Click Chemistry Tools #1263) with 2 μM Alexa Fluor 488 azide (Click Chemistry tools #1275 ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Lucy Nevard, et al.,
bioRxiv - Biophysics 2021
Quote:
... to transduce the vibrations to the flower by fixing a metal rod to the vibrating plate of the speaker and attaching a pair of very fine tipped forceps (Fine Science Tools, Dumont #5 Biology Tip Inox Forceps) to the end of the rod ...