1 - 50 of 535
suppliers found for
Estradiol Serum ELISA Kit 5 Plate
» view 10000+ matched products-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in Parasitologia doi: 10.3390/parasitologia1010001Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ... -
Millipore Sigma
No products found because this supplier's products are not listed.Cited in Periplasmic protein EipA determines envelope stress resistance and virulence in Brucella abortusbioRxiv - Microbiology 2018, published in Molecular Microbiology doi: 10.1111/mmi.14178Quote: Mouse serum Immunoglobulin G (IgG) titers were measured using an ELISA in 96-well ELISA plates (Nunc-immuno MaxiSorb, Sigma). Total mouse serum IgG ... -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: Enhanced ELISA plates (Corning) were coated with diluted anti-IFNγ antibodies (2 μg/mL ... -
R&D Systems
No products found because this supplier's products are not listed.Cited in Environmental Optimization Enables Maintenance of Quiescent Hematopoietic Stem Cells Ex VivobioRxiv - Cell Biology 2018, published in Cell Reports doi: 10.1016/j.celrep.2019.06.008Quote: The serum was subjected to an ELISA using a Quantikine ELISA Kit (R&D Systems) -
abcam
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in PLOS ONE doi: 10.1371/journal.pone.0209732Quote: ... Serum albumin was measured by ELISA (Abcam) as was serum IgG (Affymetrix). -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: Serum and CSF Fetuin-A was measured with an ELISA kit (ELISA Kit, BD ELISA MBS019821 ... -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Physiology 2021Quote: ... and serum fasting insulin was assessed using mouse insulin ELISA kit (Alpco Diagnostics ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in Biology of Reproduction doi: 10.1093/biolre/ioz085Quote: ... ELISA kits for measurement of 17β-estradiol were from Cayman Chemical (Ann Arbor, MI). -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Cell Reports doi: 10.1016/j.celrep.2019.08.050Quote: ... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in eLife doi: 10.7554/eLife.51188Quote: ... Serum IgE was assessed by ELISA (BioLegend). To deplete CD4+ T cells ... -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in eLife doi: 10.7554/eLife.54721Quote: ... Insulin was measured in serum with an ultra-sensitive mouse insulin ELISA kit (Mercodia). Corticosterone in serum was measured by ELISA kit (Enzo) ... -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018, published in Frontiers in Immunology doi: 10.3389/fimmu.2018.01069Quote: ... Serum insulin was measured by ELISA kit using a rat insulin standard (Crystal Chem, Downers Grove, IL). Body composition was determined by nuclear magnetic resonance using a Bruker Minispec instrument (Bruker ... -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in eLife doi: 10.7554/elife.42628Quote: ... concentrations measured using commercially available ELISA kits and an EL800 plate reader (BioTeK). Mice were housed in individual metabolic cages for 72 hours and urine collected for the final 24 hours ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in Neuropharmacology doi: 10.1016/j.neuropharm.2018.11.019Quote: ... and 5% goat serum (Jackson ImmunoResearch) in 0.1 M PBS for 72 h at 4 °C ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Physiological Reports doi: 10.14814/phy2.14636Quote: ... Serum vasopressin levels were measured using an Arg8-Vasopressin ELISA Kit (Enzo Life Sciences,). All assay kits were used according to manufacturer specifications. -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: ... blocked with 5% BSA/5% normal goat serum (Vector Laboratories) in PBS-T ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Angiogenesis doi: 10.1007/s10456-019-09703-yQuote: ... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ... -
Atlanta Biologicals
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019, published in Nature Communications doi: 10.1038/s41467-020-16315-4Quote: ... 5% fetal calf serum (Atlanta Biologicals), 2% B-27 (Life Technologies) ... -
Monobind
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... serum FSH was assayed using ELISA kit (Monobind Inc. USA; product number: 506-300A), and serum LH was assayed using ELISA kit (Monobind Inc ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Genetics 2017, published in Nature Communications doi: 10.1038/s41467-017-00895-9Quote: ... Serum GIP was analyzed using Millipore's Human GIP Total ELISA (Merck, Darmstadt ... -
Qiagen
No products found because this supplier's products are not listed.Cited in Programmed genome editing of the omega-1 ribonuclease 1 of the blood fluke, Schistosoma mansonibioRxiv - Molecular Biology 2018, published in eLife doi: 10.7554/elife.41337Quote: ... which were provided in the ELISA kit (Qiagen). Three biological replicates were undertaken. -
Elabscience Biotechnology
No products found because this supplier's products are not listed.Cited in Potential of host serum protein biosignatures in the diagnosis of tuberculous meningitis in childrenbioRxiv - Immunology 2019Quote: Serum cathelicidin LL-37 levels were evaluated using an ELISA kit purchased from Elabscience Biotechnology Inc ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2019, published in Matters doi: 10.19185/matters.201906000003Quote: ... ELISA plates were read at 450 nm on a plate reader (Molecular Devices). Specific concentrations for each sample were determined as mean absorbance using a standard curve of samples ranging from 0 to 8000 pg/ml. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Mouse albumin ELISA kit (Bethyl Lab, Hamburg, Germany), paraformaldehyde (Merck ... -
Boster
No products found because this supplier's products are not listed.bioRxiv - Pathology 2019Quote: ... Serum IL1β was detected by Elisa kit (Boster Biological Technology). -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... IL-8 ELISA kits were from Peprotech (London) -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018, published in Oncotarget doi: 10.18632/oncotarget.24588Quote: ... and 5% goat serum (GE Healthcare, UK) for 1 h ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017Quote: ... 5% Tet-System approved Fetal Bovine Serum (FBS, ClonTech), 100 U/ml penicillin and 100 µg/ml streptomycin ... -
MP Biomedicals
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2019, published in Scientific Reports doi: 10.1038/s41598-019-43747-wQuote: Plasma corticosterone and plasma estradiol concentrations were measured using commercially available kits (MP Biomedicals) and conducted using the manufacturer’s specifications ... -
MyBioSource
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019Quote: ... Serum procollagen type III N-terminal propeptide (P3NP) levels were measured with enzyme-linked immunosorbent assay (ELISA) kit (MyBioSource, San Diego, CA, USA). -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0225869Quote: ... Absorbance was read at 550 nm in an ELISA plate reader (Sunrise, Tecan, Milan, Italy), and the results expressed as relative change with respect to the controls set as 100%. -
BMG Labtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in Immunology and Cell Biology doi: 10.1111/imcb.12041Quote: ... ELISA plates were read using a FLUOstar Optima plate reader (BMG LabTech). -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2017, published in The Journal of Neuroscience doi: 10.1523/jneurosci.1737-17.2018Quote: ... 5% heat-inactivated fetal calf serum (Lonza), and 1 ml/l MITO+ Serum Extender (BD Biosciences) ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018, published in Journal of Biological Chemistry doi: 10.1074/jbc.RA119.009451Quote: ... blocked with 5% neutralized goat serum (Jackson laboratories) and immunostained anti-dElys (1:1000) ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Phospho-VEGFR-2 (Tyr1175) Sandwich ELISA Kit was from Cell Signaling Technology. Mouse albumin ELISA kit (Bethyl Lab ... -
Abnova
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019Quote: Estradiol concentrations within attached EB media were analyzed using commercially available enzyme-linked immunosorbent assay (ELISA) kits (Abnova, Zhongli, Taiwan). Three media samples from each condition were collected at day 0 ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2018, published in Nature Communications doi: 10.1038/s41467-018-07667-zQuote: ... Serum samples were diluted 1/250 in ELISA diluent (Mabtech, Cat: 3652-D2). Diluted serum samples were added 100 μl/well and incubated for 30 min at room temperature ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018Quote: ... Estradiol was measured by chemiluminescence (Beckman Coulter, Brea, CA), inter- and intra-assay CV 8.2% and 4.3% ... -
Cell Biolabs
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019Quote: ... PBS-washed sections were blocked with 5% goat serum (Dako, Hamburg, Germany) prior to primary antibody incubation ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0222685Quote: ... 50 ul of the conditioned medium from each transfection was incubated in one well of a 96-well ELISA plate (UltraCruz® ELISA Plate, high binding, 96 well, Flat bottom, Santa Cruz Biotechnology) at 37°C for 1 hr to allow protein in the media to adsorb to the plates ... -
Alpha Diagnostic
No products found because this supplier's products are not listed.Cited in Management of Hsp90-Dependent Protein Folding by Small Molecule Targeting the Aha1 Co-ChaperonebioRxiv - Biochemistry 2018, published in Cell Chemical Biology doi: 10.1016/j.chembiol.2020.01.008Quote: ... The Human PSA ELISA Kit (Alpha Diagnostic International, ADI) to quantify secreted PSA in the media was used ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Nature Communications doi: 10.1038/s41467-019-13864-1Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ... -
RayBiotech
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2019Quote: ... Serum renin levels were determined using an ELISA kit (ELM-Renin1-1, RayBiotech). -
Arbor Assays
Estradiol Serum ELISA / assay KitCat# KB30-H5, 1.0 ea, USD $1150.0 AskbioRxiv - Animal Behavior and Cognition 2018, published in Alcohol doi: 10.1016/j.alcohol.2018.10.002Quote: ... 5 μl plasma samples were processed with a commercially available colorimetric ELISA kit (Arbor Assays; Ann Arbor, MI), according to the manufacturer’s instructions ... -
Sanquin
No products found because this supplier's products are not listed.Cited in The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019, published in Nature Communications doi: 10.1038/s41467-020-16583-0Quote: ... supplemented with 5% human serum (Sanquin), to sustain survival of immune cells in the reconstructed microenvironment (day 19) ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in PLOS Pathogens doi: 10.1371/journal.ppat.1007940Quote: ... with 5% fetal bovine serum (FBS) (VWR Seradigm, Radnor, PA), 1X Penicillin/Streptomycin/Glutamine (P/S/G ...