-
No products found
because this supplier's products are not listed.
Hiroyuki Yamazaki, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... camptothecin (CPT-11, TopoGEN), etoposide (VP-16 ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Miwa Umebayashi, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Methyl beta cyclodextrin was purchased from CycloLab. Cholesterol-water soluble ...
-
No products found
because this supplier's products are not listed.
Larissa Melo do Nascimento, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... were grown in HMI-11 medium (PAN Biotech). Cells with selectable VSG2 expression were a kind gift from Gloria Rudenko (Imperial College) ...
-
No products found
because this supplier's products are not listed.
Lynlee M. Stevey-Rindenow, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Size 11 (Curad®, Medline, Mundelein, IL, USA), and Elastikon (Johnson & Johnson Consumer Companies ...
-
No products found
because this supplier's products are not listed.
Robert W. Robey, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and 17-AAG were purchased from ChemieTek (Indianapolis, IN). Romidepsin was obtained from Selleck Chem (Houston ...
-
No products found
because this supplier's products are not listed.
Kevin S. Johnson, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 0.2% (wt/vol) beta-cyclodextrin (Spectrum Labs, Gardena, CA) (CHBA ...
-
No products found
because this supplier's products are not listed.
Eline Berends, et al.,
bioRxiv - Neuroscience 2023
Quote:
Within the PIMSoft software (Version 1.11.0.22471 Beta, PeriMed, Järfälla, Sweden) regions of interest were placed on the barrel cortex on both the left and right hemisphere (10mm2) ...
-
No products found
because this supplier's products are not listed.
Meitham Amereh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Potassium iodide (CAS# 7681-11-0) from Caledon laboratory, Citric acid monohydrate (CAS# 5949-29-1 ...
-
No products found
because this supplier's products are not listed.
Bo Liang, et al.,
bioRxiv - Microbiology 2020
Quote:
... ethanol (CAS 64-17-5) (Spectrum Chemicals, New Brunswick, NJ) was used as supplied ...
-
No products found
because this supplier's products are not listed.
Daniël P. Melters, et al.,
bioRxiv - Biochemistry 2019
Quote:
... with SC1000 ORIUS 11 megapixel CCD camera (Gatan, Inc. Warrendale, PA).
-
No products found
because this supplier's products are not listed.
Fulin Ma, et al.,
bioRxiv - Neuroscience 2022
Quote:
Beta amyloid (Aβ1-42) aggregation kit was purchased from rPeptide (A-1170-2). To produce fibrillar Aβ ...
-
No products found
because this supplier's products are not listed.
Shruti Chatterjee, et al.,
bioRxiv - Pathology 2023
Quote:
HUVECs were obtained from 20 different donors (11 males, 9 females) (PromoCell; Heidelberg, Germany). Cells were plated at a density of 10,000 cells/cm2 and cultured in Endothelial Cell Basal Medium (ECBM ...
-
No products found
because this supplier's products are not listed.
Saurabh Joshi, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Separation of peptides was performed on 17 cm frit-less silica emitters (New Objective, 0.75 µm inner diameter), packed in-house with reversed-phase ReproSil-Pur C18 AQ 1.9 µm resin (Dr ...
-
No products found
because this supplier's products are not listed.
Zhen Xu, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Libraries were prepared using the NGS Prep Kit for sgRNA Libraries in pRSG16/17 (KOHGW, CELLECTA, LNGS-120) and Supplementary Primer Set for LNGS-120 (CELLECTA ...
-
No products found
because this supplier's products are not listed.
Marie Sémon, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... and 295 genes belonging to 8 pathways active in tooth development (17 genes in ACTIVIN pathway, 81 in BMP, 10 in EDA ...
-
No products found
because this supplier's products are not listed.
Julia R. Port, et al.,
bioRxiv - Microbiology 2021
Quote:
The aerosol transmission system consisted of two 7” X 11” X 9” plastic hamster boxes (Lab Products, Inc.) connected with a 3” diameter tube (Supplementary Figure 1) ...
-
No products found
because this supplier's products are not listed.
Emma Rusilowicz-Jones, et al.,
bioRxiv - Cell Biology 2020
Quote:
... an 11-point dilution series of compounds were dispensed into black 384-well plates using an Echo (Labcyte). USP30 ...
-
No products found
because this supplier's products are not listed.
Elizabeth V. Wasmuth, et al.,
bioRxiv - Biochemistry 2022
Quote:
3.5 microliters of Grafix purified complex with ARE35 DNA (Fraction 11) was applied to glow discharged R1.2/1.3 holey carbon grids (Quantifoil) at 4ºC and plunge frozen in liquid ethane using a Vitrobot Mark IV (Thermofisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Jennifer Doucet, et al.,
bioRxiv - Plant Biology 2019
Quote:
... Amino acid sequences were retrieved from EnsemblPlants (Actinidia chinensis, Beta vulgaris, Arabidopsis lyrata, Brassica oleracea, Corchorus capsularis, Cucumis sativus, Daucus carota, Medicago truncatula ...
-
No products found
because this supplier's products are not listed.
Michael C Farruggia, et al.,
bioRxiv - Neuroscience 2019
Quote:
... The gustometer system (51) is a portable device controlling 11 programmable BS-8000 syringe pumps (Braintree scientific, Braintree, Ma). Pumps are loaded with 60 mL syringes filled with milkshake ...
-
No products found
because this supplier's products are not listed.
Jin Gao, et al.,
bioRxiv - Microbiology 2020
Quote:
Madin-Darby canine kidney 2 (MDCK.2; CRL-2936) cells and HEK 293T/17 cells (CRL-11268) were both obtained from LGC Standards and cultured at 37 °C with 5% CO2 and ~95% humidity in DMEM containing 10% FBS and 100 U/ml P/S ...
-
No products found
because this supplier's products are not listed.
Kelly M. Hennessey, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the C terminus of GL50803_8445 was tagged with an 11-amino acid flexible linker and the fluorescent protein mNeonGreen (Allele Biotechnology). The mNG-N11-Neo vector was constructed for this purpose by amplifying mNeonGreen using the primers listed in Table S1 ...
-
No products found
because this supplier's products are not listed.
Andrew McEwan, et al.,
bioRxiv - Genetics 2020
Quote:
... CpGs 4-8 (F– TTTAGTAGAGGAAATAAAATAGTAGAAAAA-Biotinylated; R: CCCCAAAAAACCACAAAACCTA) CpGs 9-11 (F – GGATGGAGGAATTTTTTTGTGTT; R: CCCCAAAAAACCACAAAACCTA -Biotinylated) using MyTaq HS mix PCR reagents (Bioline). Amplicons were processed on the Qiagen Q24 Workstation and sequenced in duplicate on the Qiagen Q24 pyrosequencer using the sequencing primers CpGs 4-8 (AACAATTTAAACAAAAAATAACATT ...
-
No products found
because this supplier's products are not listed.
AS Speranskaya, et al.,
bioRxiv - Molecular Biology 2020
Quote:
The premixed and purified PCR products (of 17-300 ng per sample) were sheared in microTUBE-50 AFA Fiber Screw-Cap (PN 520166) using Covaris M220 (Covaris, Woburn, MA) using the following settings ...
-
No products found
because this supplier's products are not listed.
Matthew Smith, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Fura-2 AM was imaged using alternate excitation filters at 340/26 (Semrock) and 387/11 (Semrock) and a 525/40 emission filter (Chroma Technology). The system was controlled using Olympus CellR software.
-
No products found
because this supplier's products are not listed.
Naofumi Amioka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Systolic blood pressure was measured at week 11 after the injection of AAV using a non-invasive tail-cuff system (Coda 8, Kent Scientific) following our standard protocol described previously.23 Conscious mice were restrained in a holder and placed on a heated platform ...
-
No products found
because this supplier's products are not listed.
Jared R. Bagley, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The back wall of the box is attached to the mouse cage (7 1/2” × 11 1/2” × 5”, N10 Polycarbonate Mouse Cage, Ancare, NY USA) via thumbscrews or hinges attached with thumb screws for the servo access-control version ...
-
β-Estradiol 17-acetate is a metabolite of estradiol.
Cat# 1743-60-8,
Inquire
Ask
M Carter, et al.,
bioRxiv - Genetics 2020
Quote:
... and grown in HMI-9 medium containing Dox (when appropriate) plus melarsoprol at 17 nM or 35 nM melarsoprol (BoC sciences, CAS 494-79-1). Melarsoprol stocks were diluted in DMSO and cultures treated for the indicated duration (Fig ...
-
No products found
because this supplier's products are not listed.
Miki Kawada-Matsuo, et al.,
bioRxiv - Microbiology 2019
Quote:
... and 10 µl of the bacterial suspension (105 cells) was inoculated into 500 µl of PB with or without human antimicrobial peptides (beta-defensin-3; Peptide Institute Inc., Osaka, Japan, or LL37; 0.6 μM) and incubated aerobically for 2 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Jing Zhao, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and GST antibody (Tiangen).
-
No products found
because this supplier's products are not listed.
Verica Vasić, et al.,
bioRxiv - Neuroscience 2022
Quote:
... As primary antibody a polyclonal rabbit anti-human EGFL7 antibody (1:50, ReliaTech GmbH) was applied ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Polyclonal antibody to human epidermal transglutaminase (TG3) (Zedira) (1/2000) ...
-
No products found
because this supplier's products are not listed.
Jérémie Courraud, et al.,
bioRxiv - Genetics 2022
Quote:
... specific primary antibodies were used: anti-UPF3B (NSJ BIOREAGENTS), anti-PQBP1 (NOVUSBIO) ...
-
No products found
because this supplier's products are not listed.
Stéphane Pillet, et al.,
bioRxiv - Immunology 2021
Quote:
... SARS-CoV NP primary antibody (EastCoast Bio; ME, USA) and a Goat Anti-Mouse IgG conjugate antibody (Fitzgerald ...
-
No products found
because this supplier's products are not listed.
Lei Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... The following antibodies were used: anti-CD11b (Biogems, CA), anti-F4/80 (Biolegend ...
-
No products found
because this supplier's products are not listed.
M.M. Joglekar, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... VCAN (1:200, Mouse Anti-Versican Antibody 2B1, Seikagaku), and ELN (1:400 ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
Craig T. Jacobs, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... for fluorescent detection of antibody staining and Draq5 (1:10,000, Biostatus) was used for nuclear staining ...
-
No products found
because this supplier's products are not listed.
Elsa Mazari-Arrighi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... rabbit anti-rat albumin antibody (RaRa/ALB/7S, Nordic-MUbio, Netherlands) was used as primary antibody and biotinylated goat anti-rabbit antibody (VECTASTAIN Elite ABC HRP Kit ...
-
No products found
because this supplier's products are not listed.
Simon N. Chu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3% antibody serum (heat-inactivated; Atlanta Biologicals, Flowery Branch, GA, USA), 2% human plasma (from umbilical cord blood) ...
-
No products found
because this supplier's products are not listed.
Kirsten L. Viola, et al.,
bioRxiv - Neuroscience 2021
Quote:
... antibodies mentioned above were conjugated with DOTA-NHS-ester (Macrocyclics, Dallas, TX) and then radiolabeled with 64Cu.
-
No products found
because this supplier's products are not listed.
Asish K Ghosh, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... and subjected to western blotting using antibodies against PAI-1 (Molecular Innovations, Inc.), type I collagen (Southern Biotech) ...
-
No products found
because this supplier's products are not listed.
Jan Stephan Wichers, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... secondary IgG antibody (goat anti-human IgG QDot™800, Grace Bio-Labs #110635), secondary IgM antibody (biotin-SP-conjugated goat anti-human IgM ...
-
No products found
because this supplier's products are not listed.
Xiaowei Hou, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The sequence of the antibody was determined by cDNA sequencing of hybridoma cells (SYD Labs). Intact IgG was expressed using mouse hybridoma cells ...
-
No products found
because this supplier's products are not listed.
Jessica Eira, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Incubation of the secondary antibodies donkey anti mouse Alexa Fluor 568 (1:1000, Alfagene, A10037) and donkey anti rabbit Alexa Fluor 647 (1:500 ...
-
No products found
because this supplier's products are not listed.
Kartikeya Vijayasimha, et al.,
bioRxiv - Immunology 2022
Quote:
... Transfected cells were allowed to recover for two days and were then labelled at 4°C with anti-Thy1.1 antibody (clone HIS51, eBiosciences) for 30 minutes in PBS buffer containing 0.1% BSA (Amresco). Cells were then washed in buffer and incubated with anti-mouse IgG microbeads beads (Miltenyi Biotech ...
-
No products found
because this supplier's products are not listed.
Robert G. Orr, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The myosin XIa-CCT antibody was developed against a 6xHis fusion of the myosin XIa-CCT (Capralogics, Inc. Hardiwick, MA).
-
Native Antigen
Cat# AD006-100,
100µl USD $1475.0
Ask
Jiarui Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... wild type cells were incubated with 100 μL Hybridization Buffer containing 2 μL 12.5 μM CF568-labled gRNA FISH probes and 1:500 anti-Spike antibodies (Cat# PAB21477-500, The Native Antigen Company) for 4 hours in the dark ...