-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Joshua F.E. Koenig, et al.,
bioRxiv - Immunology 2023
Quote:
... or 300 ng/ml NP-BSA conjugated to digoxigenin following supplier recommendations (ANP technologies, 90-1023-1KT) for 90 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Preeti Sareen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Fly arenas were prepared by pouring agarose based foods in two-compartment petri-dishes (90-100 mm diameter) from Kord Valmark, EMS ...
-
No products found
because this supplier's products are not listed.
Nicholas A. Pudlo, et al.,
bioRxiv - Microbiology 2020
Quote:
... Reference based genome assemblies were generated using a 90% identity threshold in SeqMan NGen (DNASTAR) to determine coverage and generate corresponding read-mapping histograms ...
-
No products found
because this supplier's products are not listed.
Diego Balboa, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 60 min and 90 to measure blood glucose and circulating human C-peptide levels by ELISA (Mercodia).
-
No products found
because this supplier's products are not listed.
Adele Stewart, et al.,
bioRxiv - Neuroscience 2022
Quote:
... brains from WT (n=4) and DAT Val559 (n=4) male mice were harvested and stained using the FD Rapid GolgiStain kit (FD Neurotechnologies, cat # PK401, Columbia, MD, USA) per the manufacturer’s instructions[41 ...
-
No products found
because this supplier's products are not listed.
Sammy M. Njenga, et al.,
bioRxiv - Epidemiology 2019
Quote:
... and recombinant measles nucleoprotein (MV-N, Meridian Life Sciences, Memphis, TN) [30] were purchased from commercial sources ...
-
No products found
because this supplier's products are not listed.
Tomer Milo, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Samples were reconstituted in 10% methanol and 90% assay buffer provided by the kit manufacturer and cortisol was quantified using competitive Enzyme-Linked Immunosorbent Assays (ELISA; Salimetrics Europe ...
-
No products found
because this supplier's products are not listed.
Eric Vallabh Minikel, et al.,
bioRxiv - Neuroscience 2019
Quote:
... StageTips38 comprised of two punches of C18 material (Empore 66883-U) fitted into a 200 µL pipette tip using a 16 gauge needle with 90° blunt ends (Cadence Science 7938) and a PEEK tubing puncher (Idex 1567 ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Samy Carbonnel, Laurent Falquet, Ora Hazak,
bioRxiv - Plant Biology 2022
Quote:
A list of 256 CLE proteins obtained in multiple species (A. thaliana, N. attenuata, S. tuberosum, Populus trichocarpa, Medicago truncatula ...
-
No products found
because this supplier's products are not listed.
Gabriella T. Heller, et al.,
bioRxiv - Biophysics 2020
Quote:
... recombinant Aβ42 peptide (the 42-residue variant lacking the N-terminal M, see ‘Preparation of recombinant Aβ peptides’) was purchased from rPeptide and prepared following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Cody A. Cushing, et al.,
bioRxiv - Neuroscience 2023
Quote:
... measured by the Behavioral Activation Scale (BAS) and Eysenck Personality Questionnaire-Neuroticism (EPQ-R-N) (Carver & White, 1994; Eysenck & Eysenck, 1993). Participants were ineligible if meeting any of the following criteria ...
-
No products found
because this supplier's products are not listed.
Yunfang Li, Jianming Wu,
bioRxiv - Immunology 2024
Quote:
... and IgG4κ (purity >95%) were obtained from Athens Research and Technology (Athens ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Nathalie A. Reilly, et al.,
bioRxiv - Genomics 2024
Quote:
... and 20% Dimethyl Sulfoxide (DMSO) (WAK-Chemie Medical GmbH, WAK-DMSO-10) medium ...
-
No products found
because this supplier's products are not listed.
Jasvinder S. Ahuja, et al.,
bioRxiv - Genetics 2021
Quote:
... cells were pelleted and resuspended in 4 mL YPD broth containing 100 µg/mL nourseothricin sulfate (Neta Scientific) and aerated at 30°C for 12 h ...
-
No products found
because this supplier's products are not listed.
Harry C. Tjondro, et al.,
bioRxiv - Biochemistry 2020
Quote:
Human neutrophil-derived MPO (nMPO, UniProtKB, P05164, >95% purity) was from pooled donor blood (Lee BioSolutions). The purity ...
-
No products found
because this supplier's products are not listed.
Patrick B. Timmons, Chandralal M. Hewage,
bioRxiv - Biochemistry 2021
Quote:
The palustrin-Ca peptide (MW=3304 g mol-1, purity >95%) was purchased from ProteoGenix (Paris). 4.5 g of the peptide was dissolved in 0.6 mL of a 50% (v/v ...
-
No products found
because this supplier's products are not listed.
Abigail J. D’Souza, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Samples (0.3 ug) were loaded to each lane into the Wes™ assay plate (Protein Simple), and 12 to 230 kDa separation modules were used ...
-
No products found
because this supplier's products are not listed.
Philippe Dehio, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The thawed cells were resuspended in complete medium & 10 ng / ml GM-CSF and 100 ng / ml LPS (Lucerna Chem, Cat. # abx082480) and matured for 14 h for migration experiments.
-
Cat# IMS206-BFR-100,
USD $59.0/100.0ml
Ask
Francesco R. Simonetti, et al.,
bioRxiv - Microbiology 2020
Quote:
... We stimulated 10-100 million PBMCs with either lysates of CMV-infected fibroblasts (Virusys,10 μg/mL) or overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Benjamin J Hardy, et al.,
bioRxiv - Biochemistry 2022
Quote:
The thawed cell pellet was resuspended in 100 ml 1x phosphate-buffered saline (PBS) and passed through a continuous flow cell disruptor (Constant Systems) at 25 KPSI ...
-
No products found
because this supplier's products are not listed.
Vivian K. Chen, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... growth was in 100 mL at 30°C in SC complete (YNB + Nitrogen #1501-500, SC-1300-500, Sunrise Science Products) based media supplemented with 2% Glucose (BD-Difco-215510 ...
-
No products found
because this supplier's products are not listed.
Adam Sychla, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Two mL of culture was spread over LB agar plates with 100 µg/mL Ampicillin and 5% defibrinated sheep’s blood (Hardy Diagnostics SB30) and allowed to rest for 2 min ...
-
No products found
because this supplier's products are not listed.
Timothy Q. Vu, Lucas E. Sant’Anna, Neha P. Kamat,
bioRxiv - Bioengineering 2022
Quote:
... Triton-X-100 (LabChem) was purchased from Fisher Scientific.
-
No products found
because this supplier's products are not listed.
Marlys S. Fassett, et al.,
bioRxiv - Immunology 2021
Quote:
... SLIGRL (100 nmol; Peptides International), α-methyl-5-hydroxytryptamine (500 μg ...
-
No products found
because this supplier's products are not listed.
Ido Lavi, et al.,
bioRxiv - Microbiology 2023
Quote:
... Immunoprecipitation was performed with protein A/G Dynabeads (ThermoFisherScientific, #100-02D/100-04D) bound with Rat anti-LANA (Advanced Biotechnologies, cat#13-210-100), Rabbit anti-MeCP2 (Abcam ...
-
No products found
because this supplier's products are not listed.
Wenxin Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... RBPMS (1:100, Phosphosolutions, 1832-RBPMS), Calbindin (1:5000 ...
-
No products found
because this supplier's products are not listed.
Xiaodan Zhang, et al.,
bioRxiv - Genomics 2021
Quote:
... anti-mouse Lyve1 antibody (1:100, AngioBio cat.no ...
-
No products found
because this supplier's products are not listed.
Joy Lachat, et al.,
bioRxiv - Microbiology 2021
Quote:
... a Piezo stage (Prior Scientific, NanoScanZ 100), an environmental chamber with temperature control set to 37°C and a Definite Focus 2 device (Zeiss ...
-
No products found
because this supplier's products are not listed.
Jun Inamo, et al.,
bioRxiv - Genetics 2022
Quote:
... Total RNA preparation (100 μg) was added to 100 μL nuclease-free water and poly-A selected using NEXTflex Poly(A) Beads (BIOO Scientific) according to the manufacturer’s instructions and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Martin P. Reichhardt, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... mouse anti-C4bp (Quidel, San Diego, California; 1:100), rabbit anti-C1q (DAKO Denmark A/S ...
-
No products found
because this supplier's products are not listed.
Priscille Riondel, et al.,
bioRxiv - Neuroscience 2022
Quote:
... using the vertical PC-100 puller (Narishige International Ltd) and filled with an internal solution supplemented with 10 μM of the fluorescent dye AlexaFluor 594 (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Jesus M. Duran Ramirez, et al.,
bioRxiv - Microbiology 2022
Quote:
... 100 uL of either sterile saline (McKesson, cat# 186661) or the TAPI (prepared as described above ...
-
No products found
because this supplier's products are not listed.
Lucile Fievet, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and incubated in 1.5 mL of collagenase (NB5, 1 U/mL, Nordmark Biochemicals) for 60 min at 37°C ...
-
Cat# FN10100,
100µL, USD $145.00/100µL
Ask
Camille Morel, et al.,
bioRxiv - Biophysics 2023
Quote:
... was used at 100 nM via magnetofection technology (OZ Biosciences) following the manufacturer’s instructions in serum-free OptiMEM (Gibco) ...
-
No products found
because this supplier's products are not listed.
Ronald Rodriguez, et al.,
bioRxiv - Microbiology 2022
Quote:
... CLR (Ambeed, 1 μg/ml), and AMK (Ambeed ...
-
No products found
because this supplier's products are not listed.
Si Qiu, et al.,
bioRxiv - Immunology 2019
Quote:
... The fluorescently labeled secondary antibody (1:100) Dylight 488(Abbkine, A23220) and Dylight 549(Abbkine ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... depleted plasma was supplemented with purified FXI (100 pM; Haematologic Technologies) or FXII (1.2 nM ...
-
No products found
because this supplier's products are not listed.
Shuo Geng, et al.,
bioRxiv - Immunology 2023
Quote:
... 10 µg/mL oxLDL (Kalen Biomedical), 10 µg/mL cholesterol (MilliporeSigma) ...
-
No products found
because this supplier's products are not listed.
Esther A. Mozipo, et al.,
bioRxiv - Bioengineering 2023
Quote:
Sodium Hyaluronate (HA, 40 kDa and 100 kDa) was purchased from Lifecore Biomedical LLC (Chaska ...
-
No products found
because this supplier's products are not listed.
Yiyao Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... from 5 ml to 0.5 ml before application onto qEV Original SEC columns (IZON Science SP1-USD, Christchurch, New Zealand) that had been pre-rinsed with 15 ml PBS ...
-
No products found
because this supplier's products are not listed.
Elsio Wunder Jr., et al.,
bioRxiv - Microbiology 2020
Quote:
... the arrays were probed at 1/100 dilution in protein array blocking buffer (GVS) supplemented with E ...
-
No products found
because this supplier's products are not listed.
Amanda K Gibson, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... we seeded 100 mm petri dishes of Nematode Growth Media (NGM-lite, United States Biological) with 35 uL of bacterial parasites (Serratia marcescens ...
-
No products found
because this supplier's products are not listed.
Jubina Balan Venghateri, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Hoechst 33342 (1 μg/ml; ImmunoChemistry Technologies, Bloomington, MN, USA) and propidium iodide (250 ng/ml ...
-
No products found
because this supplier's products are not listed.
Yuanchen Yu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The channel array was maintained at 37 °C with a TC-1-100s temperature controller (Bioscience Tools). For all direct comparisons ...
-
No products found
because this supplier's products are not listed.
Anne-Emmanuelle Foucher, et al.,
bioRxiv - Biochemistry 2022
Quote:
... The aligned sample contained 17 mg/mL Pf1 phage (Asla Biotech). RDC-based intervector projection angle restraints used Da and R values of 8 and 0.33 ...
-
No products found
because this supplier's products are not listed.
J.A. McPhail, et al.,
bioRxiv - Biochemistry 2019
Quote:
... substrate stocks were made up containing 1.0 mg/mL PI vesicles or 4.0 mg/mL Golgi-mimetic vesicles (10% PS, 20% PI, 25% PE, 45% PC) and were extruded through a 100 nm Nanosizer Extruder (T&T Scientific) and then combined with in a buffer containing 20 mM Hepes pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...