-
No products found
because this supplier's products are not listed.
Luis E. Martinetti, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used a virus-retrobead or saline-retrobead mixture (red RetroBeads, Lumafluor, Cat# R180). When comparing different AAV serotypes ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
Cat# F3,
USD $18.00/EA
Ask
Oliver Hsia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lysate was filtered through a BioPrepNylon Matrix Filter (BioDesign) then incubated with 1 mL Ni-NTA resin per litre culture for 1 hour ...
-
No products found
because this supplier's products are not listed.
Daniela Niemeyer, et al.,
bioRxiv - Microbiology 2021
Quote:
... and B.1.351 was assessed by a surrogate virus neutralization test (cPass Assay, Medac, Wedel, Germany) as described previously (Momsen Reincke et al. ...
-
No products found
because this supplier's products are not listed.
Susanne A. Wycislo, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Equivalent amounts of “light”-labeled control and “heavy”-labeled GFP–containing lysates or “light”-labeled control and “heavy”-labeled GFP–containing lysates were incubated (separately) with GFP-Trap agarose beads (Allele Biotechnology, San Diego, CA) for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Anna Fortuny, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Lysates were homogenised with a tight Dounce homogeniser (DWK Life Sciences) and nuclei were collected by centrifugation ...
-
No products found
because this supplier's products are not listed.
Milène Vandal, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The lysate was incubated with 100 U/mL salt-active nuclease (Arcticzymes) at 37°C for 1 h and then centrifuged at 2000 xg for 15 min ...
-
No products found
because this supplier's products are not listed.
Maayan Karlinski Zur, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... The lysates were transferred into soft tissue homogenizing CK14 tubes (Bertin Corp), placed in a homogenizer shaker at 400bps for 2 sec ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Dora Buzas, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Control wells containing virus only (no ADAH11) as well as a positive control (a commercial monoclonal antibody (Absolute Antibody; Sb#15) recognising the S protein RBD ...
-
No products found
because this supplier's products are not listed.
James Peak, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and Fluorogold (FG; 3% in saline; Fluorochrome) into the GPe and SNr ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Wenhui Qiao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Aβ oligomers in TBS and TBSX lysates were detected by commercial kits (Biosensis, BEK-2215-2P). sAPPa ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
Lenti/Retro Virus
Cat# LVB1000,
Conservation Buffer (1mL), USD $95.00/mL
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Jonathan D Teo, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Six distinct fields of view per mouse were imaged at 15,000x magnification and captured as 3×3 tile scans using the JEOL integrated software and a high-sensitivity sCMOS camera (JEOL Matataki Flash). G-ratios were calculated as the diameter of the axon lumen divided by the diameter of the lumen plus myelin sheath (Song et al. ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Thomas M. Winkelmüller, et al.,
bioRxiv - Plant Biology 2020
Quote:
... 800 µl of 3 µM flg22 (EZBiolab Inc., USA) solution was added to the medium containing the seedlings resulting in a final concentration of 1 µM flg22 ...
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Chikako Kuwabara, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3 ml/L Plant Preservative Mixture (Plant Cell Technology), and 3 g/L phytagel ...
-
No products found
because this supplier's products are not listed.
Rongkui Han, et al.,
bioRxiv - Genetics 2020
Quote:
... 600 μL of clear lysate was transferred to DNA binding plates (Epoch Life Sciences EconoSpin™ 96 well) stacked over a 1 mL collection plate and centrifuged 5 minutes (RT ...
-
No products found
because this supplier's products are not listed.
Pan Zhang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... The total protein levels of the lysates were measured by BCA protein assay kit (iNtRON Biotechnology, Cat No. 21071). The following primary antibodies were used at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Sana Charaoui-Boukerzaza, et al.,
bioRxiv - Microbiology 2019
Quote:
... The count of viable bacteria was carried out by plating serial dilutions of the lysates on blood agar (43041, bioMérieux) using an automatic seeder (EasySpiral Dilute, Interscience). The calculation of the bacterial loads was performed after incubation at 37°C for 24 h ...
-
No products found
because this supplier's products are not listed.
Siyuan Zhao, et al.,
bioRxiv - Neuroscience 2021
Quote:
... (3) Spin-coating SU-8 precursor (SU-8 2000.5, MicroChem) at 3000 rpm ...
-
No products found
because this supplier's products are not listed.
Brandon T. Cisneros, Neal K. Devaraj,
bioRxiv - Synthetic Biology 2020
Quote:
... 3-Methylxanthine was purchased from AK Scientific (Union City, CA). Xanthine was purchased from Chem Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Surya Cayre, et al.,
bioRxiv - Developmental Biology 2020
Quote:
The following primary antibodies were used on mouse cell-derived lysates: anti-mouse milk proteins (Accurate Chemical; YNRMMSP; 1/2000), anti-mouse b-casein (a kind gift from C ...
-
No products found
because this supplier's products are not listed.
F. Esra Demircioglu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The lysate was immediately mixed with 0.1 M phenylmethanesulfonyl fluoride (PMSF) (50 μl per 10 ml lysate) and 250 units of TurboNuclease (Eton Bioscience), and cleared by centrifugation ...
-
No products found
because this supplier's products are not listed.
Joshua Hutchings, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 3 μL of BSA-blocked 5 nm gold nanoparticles (BBI Solutions) were added to a 30 μL GUV BR and gently agitated just prior to vitrification ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
No products found
because this supplier's products are not listed.
Claudio A. Carril Pardo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti-Urocortin 3 (rabbit, 1:300, Phoenix Pharmaceuticals H-019-29), anti-Pdx1 (guinea pig ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Prashant Gupta, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in 3 ml of Hibernate E-Ca (HE-Ca, BrainBits, USA) for 10 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Nitchakarn Kaokhum, et al.,
bioRxiv - Biochemistry 2022
Quote:
DUB activity in cartilage tissue lysates were measured using ubiquitin-rhodamine(110)-glycine quenched substrate (Boston Biochem, cat No U-555). In the presence of active DUBS ...
-
No products found
because this supplier's products are not listed.
Sultan Ahmed, Panashe Mabeza, Derek T Warren,
bioRxiv - Cell Biology 2019
Quote:
Human adult aortic VSMCs (passage 3-10) were purchased from Cell Applications Inc (Isolate-1) ...
-
No products found
because this supplier's products are not listed.
Ningke Hou, et al.,
bioRxiv - Microbiology 2019
Quote:
... SSP4 (3’,6’-Di(O-thiosalicyl)fluorecein) was purchased from DOJINDO MOLECULAR TECHNOLOGIES (Bibli et al ...
-
No products found
because this supplier's products are not listed.
Morten Dencker Schostag, et al.,
bioRxiv - Microbiology 2019
Quote:
... Gas samples were transferred to 3-mL Exetainer vials (LABCO, Lampeter, UK) and analyzed using an autosampler (Mikrolab Aarhus ...
-
No products found
because this supplier's products are not listed.
Cinzia Klemm, Gudjon Olafsson, Peter H Thorpe,
bioRxiv - Cell Biology 2023
Quote:
3xFLAG-tagged Mif2CENP-C cells were harvested after 4 hours of growth at restrictive (37°C) or permissive (23°C) temperature and whole cell lysates were prepared using glass beads and a cell disrupter (Scientific Industries Inc.) in Laemmeli buffer containing an EDTA-free protease inhibitor cocktail (Thermo Fisher) ...
-
Dengue Virus Serotype 2 Envelope (DENV-2 E) Antibody (Strain New Guinea C/PUO-218 hybrid) is a...
Cat# abx201286-50UL,
50 µl USD $362.5
Ask
Veani Fernando, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The BH4 level in cell lysate was measured using an enzyme–linked immunosorbent assay (ELISA) Kit (Abbexa, Sugar Land, TX, Cat. No. abx354211) following manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Davia Blake, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Caspase-3/7 activity was measured with FAM-FLICA probes (Immunochemistry Technologies: 93) and MOMP events were measured with MitoTracker Red CMXRos staining (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Pooja Gupta, et al.,
bioRxiv - Biochemistry 2021
Quote:
... An initial crystallization condition was identified I the Wizards Classic 3&4 crystallisation screen (Rigaku), well F2 (40% PEG400 ...
-
No products found
because this supplier's products are not listed.
José R Pittaluga, et al.,
bioRxiv - Immunology 2024
Quote:
... A PVP-free polycarbonate membrane (3 µm pore size; Neuro Probe Inc. Gaithersburg MD, USA) separated cells from lower wells containing either RPMI or the stimulus (pRNA or CM) ...
-
No products found
because this supplier's products are not listed.
Tomer M. Yaron, et al.,
bioRxiv - Microbiology 2020
Quote:
... All the recombinant kinases (SRPK1/2/3, GSK-3α/β and CK1A/E were obtained from SignalChem.
-
No products found
because this supplier's products are not listed.
Toshiomi Katsuki, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 30 µg/body 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate labelled HDL (Dil-HDL: KALEN Biomedical, MD, USA) was used ...
-
No products found
because this supplier's products are not listed.
Brynna S. Eisele, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The volume of concentrated samples was adjusted to 70 ul and 3 ul of Chondroitinase ABC (1.4 U/ml Stock solution, containing BSA, Seikagaku) was added to each sample ...
-
No products found
because this supplier's products are not listed.
Amit Rahi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... followed by incubation for 5 min and intermittent washing with 3 chamber volumes of buffer B: PLL PEG biotin (0.1 mg ml-1, Susos, AG), Streptavidin (0.625 mg ml-1 ...
-
No products found
because this supplier's products are not listed.
Florencia Rago, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cells were treated with BRM011, BRM014, or BRM017 (11-point, 3-fold serial dilutions) in triplicate using an Echo550 (Labcyte). Viability was assessed on Day 0 and Day 5 using CTG according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Dani Flinkman, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and filtered through Whatman Grade 3 filter material and cleaned-up with C18-UltraMicroSpin columns (The Nest Group, Inc., Southborough, USA). The peptides were then dried and dissolved in 0.1 % Formic acid (FA) ...