-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Teri N. Hreha, et al.,
bioRxiv - Immunology 2023
Quote:
... O and K serotypes (1:200, Meridian Life Science #B65109G), Rat anti-Ly6G-APC (1:200 ...
-
No products found
because this supplier's products are not listed.
Mary Y. Chang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... coli serotype 0111:B4 was purchased from List Biological Laboratories (Campbell, CA). Ifn-b was from PBL Interferon Source (Piscataway ...
-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Kranti Konganti, et al.,
bioRxiv - Genomics 2023
Quote:
... and serotype identification was determined following previously published protocols (Fitzgerald et al., 2007; McQuiston et al., 2011).
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... or vesicular stomatitis virus G (VSV-G, Aldevron), using FuGENE6 (Roche ...
-
No products found
because this supplier's products are not listed.
Denisa Bojkova, et al.,
bioRxiv - Microbiology 2022
Quote:
... H1N1 (Influenza A Virus) Nucleoprotein (Bioss, #bs-4976R, 1:4000), ISG15 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
S. Jake Gonzales, et al.,
bioRxiv - Immunology 2021
Quote:
... coli lysate (MCLAB #ECCL-100) was resuspended in MQ water and added to a final concentration of 15 µg/ml ...
-
No products found
because this supplier's products are not listed.
Katharina Kases, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and anti- ZC3H11A (Atlas Antibodies, heavy lysate) antibodies in Protein LoBind tubes (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Nia Toshkova, et al.,
bioRxiv - Immunology 2023
Quote:
... measles virus mosaic hemagglutinin (viral proteins were obtained from Immune Technology, New York, NY). Plates were incubated with proteins usually diluted to 5 μg/ml in PBS ...
-
No products found
because this supplier's products are not listed.
Pawel Sledzinski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Lysates were digested with proteinase K (Norgen Biotek Corp.) and decrosslinked at 65 °C overnight ...
-
No products found
because this supplier's products are not listed.
Taeyong Kwon, et al.,
bioRxiv - Microbiology 2022
Quote:
... The same amount of the virus was mixed with 45 µL of human saliva (Lee Biosolutions) or medium and transferred into a 2 mL tube or onto stainless steel in the 12-well plate ...
-
No products found
because this supplier's products are not listed.
Bruno Vaz, et al.,
bioRxiv - Immunology 2020
Quote:
Human APCs were pre-pulsed for 4h at 37 °C with 1:50 antigen mix (HBV, influenza and CMV lysates; bulk telomere measurements) or 1:50 cytomegalovirus (CMV)-lysates (Zeptometrix Corporation; IF-FISH studies). APC-T cell conjugates were then formed by adding autologous CD27+ CD28+ CD3+ CD4+ T cells in a 3:1 ratio ...
-
No products found
because this supplier's products are not listed.
Hong-Wen Tang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Lysate was incubated with GFP-Trap agarose beads (Bulldog Bio) or anti-Flag M2 magnetic beads (Sigma ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Gila Lustig, et al.,
bioRxiv - Microbiology 2019
Quote:
... Supernatant containing released virus was harvested two days post-transfection and filtered through a 0.45 micron filter(GVS) and stored in 0.5ml aliqouts at −80°C ...
-
No products found
because this supplier's products are not listed.
Joshua D. Powell, et al.,
bioRxiv - Microbiology 2024
Quote:
... NJ) and were seronegative to IAV antibodies by a commercial ELISA kit (Swine Influenza Virus Ab Test, IDEXX) prior to the start of the study ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Sara Al Rawi, et al.,
bioRxiv - Neuroscience 2021
Quote:
Fbxo7 was immunoprecipitated from cell lysates using 2μl of anti-Fbxo7 antibody (Aviva), or isotype matched control ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Brenton T. Laing, et al.,
bioRxiv - Neuroscience 2022
Quote:
Immunostaining was conducted for axonal projections and verification of virus expression using a chicken anti-GFP polyclonal antibody (1:1000, Cat # GFP-1020, RRID:AB_10000240; Aves Labs, CA, U.S.A.) or a rabbit anti-DsRed polyclonal antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Marcus Buggert, et al.,
bioRxiv - Immunology 2020
Quote:
... bulk memory or virus-specific CD8+ T cells were sorted into cold fetal bovine serum and frozen in RNAzol (Molecular Research Center). TCRβ transcripts were amplified using a template-switch anchored RT-PCR ...
-
No products found
because this supplier's products are not listed.
Sloan A. Lewis, et al.,
bioRxiv - Immunology 2021
Quote:
Circulating endotoxin was measured from plasma using a Limulus amebocyte lysate (LAL) assay (Hycult Biotech) following the manufacturers protocol.
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
DaoFei Song, Lei Yin, Chang Wang, XiuYing Wen,
bioRxiv - Molecular Biology 2019
Quote:
... The protein concentration in tissue lysates was measured with a BCA protein assay kit (Boster, Wuhan, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Shuvasree SenGupta, et al.,
bioRxiv - Immunology 2021
Quote:
... and Purecol® (3 mg/mL, 5005, Advanced Biomatrix) in a 1:2:15 ratio ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Matthew L. Turner, et al.,
bioRxiv - Microbiology 2019
Quote:
... Potassium was measured in the cleared lysates using a Jenway PFP7 flame photometer (Cole-Parmer, Stone, Staffordshire, UK).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
... the clarified lysate was concentrated by tangential flow filtration at 5 L/min/m2 using a KR2i KrosFlo (Repligen) with Pellicon 2 mini cassettes (300 kDa ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Joke Mertens, et al.,
bioRxiv - Genetics 2021
Quote:
Day-3 embryos were warmed using the Vitrification Thaw kit (Vit Kit-Thaw, Irvine Scientific, USA) according to manufacturer’s instructions ...