-
No products found
because this supplier's products are not listed.
Grant M. Zane, et al.,
bioRxiv - Microbiology 2022
Quote:
AAV4 (and AAV5) VLP preparations were validated using the serotype-specific monoclonal antibodies ADK4 (Progen, 610147) and ADK5b (Origene ...
-
No products found
because this supplier's products are not listed.
Bioy Alexis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... supernatants (1 μg/mL of lysate) were treated with DNAse I (Eurogentec) for 1 hour on ice ...
-
No products found
because this supplier's products are not listed.
Jennifer M. Frost, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 μM Forskolin (Cambridge Bioscience), and 4% KSR ...
-
No products found
because this supplier's products are not listed.
María del Carmen Muñoz-Marín, et al.,
bioRxiv - Microbiology 2021
Quote:
... The tubes were agitated for 2 min with a Vortex-Genie 2 bead beater (Scientific Industries, Inc), and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen) ...
-
No products found
because this supplier's products are not listed.
Nathaniel C. Wright, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we inserted either a tungsten optoelectrode (2 Megaohm, FHC, with attached 200 micron optic fiber ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
Beau R. Webber, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 0.5-2 µg/µL of cell lysate was analyzed on the Wes platform (Protein Simple) after denaturation at 95 °C for 5 min ...
-
No products found
because this supplier's products are not listed.
Joydeb Sinha, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Harvested virus was 0.4μM filtered (Celltreat 229749) and concentrated by centrifugation using a 100kdA cut-off PES protein concentrator (Pierce 88533 ...
-
Native Antigen
Cat# NAT41569-100,
100ug USD $426.0
Ask
Subhasis Mahari, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Human Immunodeficiency Virus (HIV) and Avian Influenza Virus (AIV) Ag were obtained from The Native Antigen Company (Oxford, UK). Aurdino software has been used in the in-house built device and the hardware include a printed Circuit Board (PCB) ...
-
No products found
because this supplier's products are not listed.
Christine Vazquez, Chin Yee Tan, Stacy M. Horner,
bioRxiv - Microbiology 2019
Quote:
... and rabbit anti-Sendai virus (SV) (1:1000, MBL International). Secondary antibody incubations were done with Alexa Fluor conjugated antibodies (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Matthew D. Lauver, et al.,
bioRxiv - Immunology 2022
Quote:
... Virus dilutions were combined 1:1 with 0.45% sheep erythrocytes (Innovative Research) and incubated overnight at 4°C ...
-
2 Well Chambered Cover Glass with #1.5 high performance cover glass (0.170±0.005mm), with lid,...
Cat# C2-1.5H-N,
48/case, $219.00
Ask
Yuanyuan He, et al.,
bioRxiv - Microbiology 2023
Quote:
Imaging plates for virus quantification were prepared by coating coverslip-bottom wells (Cellvis) with 0.18 mg/ml BSA-biotin in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Robert C. Hurt, et al.,
bioRxiv - Bioengineering 2024
Quote:
... a lysate clearing plate from Bio Basic (SD5006), and a DNA-binding plate from Epoch Life Sciences (2020-001) ...
-
WB,ELISA
Cat# A5244, SKU# A5244-100ul,
100ul, $157.00
Ask
Qiong Wang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus quantification by real-time PCR was performed using the QPCR Mix (Bimake, Cat#B21202), following the supplier’s instruction ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Paul A. Rowley, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Human brain and testes tissue total protein lysates were purchased from ProSci Incorporated (catalogue numbers 1303 and 1313 ...
-
No products found
because this supplier's products are not listed.
Shawn Freed Jr, Nancy D. Hanson,
bioRxiv - Microbiology 2023
Quote:
... Whole cell lysates were collected by bead-beating (Next Advance Bullet Blender) and protein concentrations determined using a Bicinchoninic Acid Assay (Pierce BCA Protein Assay ...
-
No products found
because this supplier's products are not listed.
Guus Franken, et al.,
bioRxiv - Immunology 2023
Quote:
... Serially diluted lysates were arrayed on nitrocellulose-coated slides (Grace Bio-Labs) by the Quanterix (Aushon ...
-
No products found
because this supplier's products are not listed.
M. Julhasur Rahman, et al.,
bioRxiv - Microbiology 2021
Quote:
The mCherry-E3L integration sites in the purified HGT virus genomes were located by inverse PCR amplification and by PacBio sequencing ...
-
No products found
because this supplier's products are not listed.
Kevin J. Kramer, et al.,
bioRxiv - Immunology 2021
Quote:
... values at the endpoint (48 h after incubation with the virus) were determined using the RTCA software version 2.1.0 (ACEA Biosciences Inc.). Results are expressed as percent neutralization in a presence of respective antibody relative to control wells with no CPE minus CI values from control wells with maximum CPE ...
-
No products found
because this supplier's products are not listed.
Helmut Bischof, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Glucose uptake was assessed using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2- NBDG) (Biomol GmbH). Therefore ...
-
No products found
because this supplier's products are not listed.
Xiaofeng Zheng, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Insulin and protein content of the lysate were measured using Mouse Insulin ELISA (Mercodia) and BCA assay (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Lucy Chou-Zheng, Asma Hatoum-Aslan,
bioRxiv - Microbiology 2022
Quote:
... Cleared lysates were passed through a 5 ml gravity column (G-Biosciences, MO, USA) containing 1.5 ml of Ni2+-NTA agarose resin (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Federica Cappuccini, et al.,
bioRxiv - Immunology 2021
Quote:
Mouse MHC samples and all tryptic digested lysates were analysed on a TripleTOF 5600 (SCIEX) coupled to an Eksigent ekspert nanoLC 400 cHiPLC system ...
-
No products found
because this supplier's products are not listed.
Saliha Musovic, et al.,
bioRxiv - Physiology 2021
Quote:
... P2Y2R protein levels were determined in cell lysate with specific mouse ELISA (catalog # MBS7200782, MyBioSource).
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... LDH-B activity was measured in cell lysates using the LDH activity assay kit (Elabscience) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
DaoFei Song, Lei Yin, Chang Wang, XiuYing Wen,
bioRxiv - Molecular Biology 2019
Quote:
... The protein concentration in tissue lysates was measured with a BCA protein assay kit (Boster, Wuhan, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Gordon Rix, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... Lysate was clarified by spinning 14,000g for 20 min at 4 °C (New Brunswick Avanti J-30I). Protein was purified over hand-packed HisPur™ Ni-NTA Resin (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Hao Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 2-amino-N-(2-aminoethyl)-benzamide (AEAB) was purchased from Chem-Impex International (Wood Dale ...
-
No products found
because this supplier's products are not listed.
Peyton J. Tebon, et al.,
bioRxiv - Bioengineering 2021
Quote:
... and secondary staining was performed with Mach 2 Double Stain 2 (Biocare) solution for 40 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Chao Hu, et al.,
bioRxiv - Immunology 2020
Quote:
... type 2 (Trevigen, USA). Drops of 40 μl BME-cell suspension were added into 24-well plates and solidified at 37°C for 10-20 min ...
-
No products found
because this supplier's products are not listed.
Megan Clapperton, et al.,
bioRxiv - Biophysics 2023
Quote:
... and fluorescence (PMT 2).
-
No products found
because this supplier's products are not listed.
Michael J. D. Daniels, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 25 μL lysate was combined with 175 μL cathepsin probe L (Z-Phe-Arg-AMC, 45 μM, Bachem) or C (H-Gly-Phe-AMC ...
-
No products found
because this supplier's products are not listed.
Aleksandr Andriianov, et al.,
bioRxiv - Microbiology 2023
Quote:
... Wells were screened by PCR for the presence of lysate with recombinant phages and T3Δ0.3 was further purified from individual plaques and verified by Sanger sequencing (Evrogen).
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Peak 2 (RCP-60-50-2) and Polystyrene DVB-COOH microspheres from Bangs Laboratories, Inc (PC07001 ...
-
No products found
because this supplier's products are not listed.
Timothy S. Balmer, Laurence O. Trussell,
bioRxiv - Neuroscience 2019
Quote:
... fluorescent microspheres (Spherotech, FP4060-2) were imaged following the same procedures used for biocytin filled cells (Figure S5).
-
No products found
because this supplier's products are not listed.
Karsten Eichholz, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 2% BSA (Gemini Bio-Products) +0.2% Triton X-100 (SigmaAldrich ...
-
LDH-A inhibitor
Sold for research purposes only.
Cat# 2450.0, SKU# 2450-5 mg,
5mg, US $99.00 / EA, EURO, €90 / EA
Ask
Irene Zorzan, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2 μM Gö6983 (Axon Medchem) and 10 ng/ml human LIF (produced in-house) ...
-
No products found
because this supplier's products are not listed.
Oliver J. Gough, et al.,
bioRxiv - Genomics 2023
Quote:
... Polyethylenimine (PEI) (Polyscience 23966-2) was added at a 3:1 PEI:DNA ratio and the mixture briefly vortexed and incubated at RT for 10-20 mins ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 1–2 M Ammonium sulfate or in sparse matrix screens: Wizard 1&2 (Molecular Dimensions), Wizard 3&4 (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Jose L. Nieto-Torres, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The in vitro kinase reaction mixtures were incubated with 350 μl clarified lysate of HeLa LC3B-KO cells (8×105 cell equivalents, prepared as described above) and glutathione-sepharose beads (Bioworld) for 3 h at 4°C on a rotator ...
-
No products found
because this supplier's products are not listed.
Preeti Sareen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... An image splitter (Photometrics DV-2) was used to split red and green channels and acquire simultaneous images for tdTomato and GCaMP6 using a Hamamatsu ORCA-R2 C10600 camera ...
-
No products found
because this supplier's products are not listed.
Nicholas O. Burton, et al.,
bioRxiv - Genetics 2021
Quote:
... mek-2 and gpdh-2 was synthesized and cloned into the L4440 vector by GENEWIZ (Takeley, UK). Vectors were transformed in E ...
-
No products found
because this supplier's products are not listed.
John Stegmayr, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... A 7000SMZ-2 Vibrotome (Campden Instruments Ltd.) equipped with a temperature controlled tissue bath (Campden Instruments Ltd. ...
-
No products found
because this supplier's products are not listed.
Sarah V. Paramore, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The probes were for Mus musculus Fgf10 (channel 2, 446371) and Wnt5a (channel 2, 316791) and the fluorophores were Opal Polaris 520 and Opal 620 (Akoya Biosciences FP1487001KT and FP1495001KT) ...
-
No products found
because this supplier's products are not listed.
Maxwell C. McCabe, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and a 2-mm thumb punch (Kent Scientific) was used to generate punches across the medial ear pinna in the right and left ears ...
-
No products found
because this supplier's products are not listed.
Mai M. Abdelmoaty, et al.,
bioRxiv - Immunology 2021
Quote:
... Recombinant human IFN-α (PBL Assay Science, 11200-2) was used as assay standard ...
-
No products found
because this supplier's products are not listed.
Brian J. Caffrey, et al.,
bioRxiv - Microbiology 2024
Quote:
All STEM imaging was performed on a 300kV GRAND-ARM 2 (JEOL) with a spherical aberration corrector ...