-
No products found
because this supplier's products are not listed.
Shiwei Liu, et al.,
bioRxiv - Genomics 2020
Quote:
... parasites were grown in vitro at 37°C in solutions of 3% hematocrit (serotype A positive human erythrocytes, Valley Biomedical, Winchester, VA) in RPMI 1640 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Chenyan Ma, et al.,
bioRxiv - Neuroscience 2023
Quote:
... starting at day 3 post virus injection (250 mg tamoxifen per kg of chow, Research Diets). Mice were gavaged with two additional doses of tamoxifen (250 mg/kg body weight ...
-
No products found
because this supplier's products are not listed.
Jason Neidleman, et al.,
bioRxiv - Immunology 2020
Quote:
... or Influenza Virus Control Peptide Pool (Anaspec). As a positive control for cytokine detection ...
-
No products found
because this supplier's products are not listed.
Bettina C. Schwab, et al.,
bioRxiv - Neuroscience 2020
Quote:
We also performed microstimulation mapping of VLa and VLp (biphasic pulses <200μA, 0.2ms- duration at 300Hz; Model 2100, A-M Systems). Consistent with previous reports ...
-
No products found
because this supplier's products are not listed.
Ferdinand Roesch, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in RPMI-1640 (Genesee Scientific) media containing 2% FBS and 10 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Liriye Kurtovic, et al.,
bioRxiv - Immunology 2020
Quote:
... A volume of 50 μL of the CSP-dS VLP preparation was applied to TSKgel® G6000PWXL 7.8*300 mm column (Tosoh Bioscience GmbH, Griesheim, Germany) in loading buffer (1.7 mM KH2PO4 ...
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Fiorella Ghisays, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and 0.5 µg/ml CY-3 (CCCTAA)3 (PNA BIO), denatured at 75°C for 5 minutes and incubated at room temperature for 16hr ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Qian Zhou, et al.,
bioRxiv - Neuroscience 2021
Quote:
We delivered ∼150 nl of AAV virus with a stereotaxic instrument (David Kopf Instruments, #PF-3983; RWD Life Science, #68030) and a pressure micro-injector (Nanoject II ...
-
No products found
because this supplier's products are not listed.
Miroslav Homola, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The dialyzed virus particles were concentrated in centrifugal ultrafiltration units to 200 µl and mixed with Turbo Nuclease (Abnova, Taipei, Taiwan) at a final concentration of 25 U ml-1 to digest free nucleic acids released into solution ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 3 µM CHIR99021(ReproCELL, Kanagawa, Japan), and 1% (v/v ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Maryann P. Platt, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-Spn serotype 4 (#16747, Statens Serum Institut) and cleaved-caspase-3 (AF835SP ...
-
No products found
because this supplier's products are not listed.
Mary Y. Chang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... coli serotype 0111:B4 was purchased from List Biological Laboratories (Campbell, CA). Ifn-b was from PBL Interferon Source (Piscataway ...
-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Matthew D. Lauver, et al.,
bioRxiv - Immunology 2022
Quote:
... Virus dilutions were combined 1:1 with 0.45% sheep erythrocytes (Innovative Research) and incubated overnight at 4°C ...
-
No products found
Yuanyuan He, et al.,
bioRxiv - Microbiology 2023
Quote:
Imaging plates for virus quantification were prepared by coating coverslip-bottom wells (Cellvis) with 0.18 mg/ml BSA-biotin in PBS overnight at 4 °C ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
José-María Díez, Carolina Romero, Rodrigo Gajardo,
bioRxiv - Immunology 2020
Quote:
... Human Anti-SARS-CoV-2 Virus Spike 1 [S1] IgG ELISA Kit (Alpha Diagnostic Intl. Inc.), against S1 subunit spike protein ...
-
No products found
because this supplier's products are not listed.
Lorine Debande, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 3% BSA (Euromedex). A horseradish peroxidase-conjugated goat anti-rabbit IgG antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Sherine E. Thomas, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Wizard 3&4 (Molecular Dimensions), JCSG +Suite (Molecular Dimensions) ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Kevin J. Kramer, et al.,
bioRxiv - Immunology 2021
Quote:
... values at the endpoint (48 h after incubation with the virus) were determined using the RTCA software version 2.1.0 (ACEA Biosciences Inc.). Results are expressed as percent neutralization in a presence of respective antibody relative to control wells with no CPE minus CI values from control wells with maximum CPE ...
-
No products found
because this supplier's products are not listed.
Janhavi Prasad Natekar, et al.,
bioRxiv - Microbiology 2022
Quote:
Tissues harvested from virus-inoculated animals were weighed and homogenized in a bullet blender (Next Advance, Averill Park, NY, USA) using stainless steel or zirconium beads ...
-
No products found
because this supplier's products are not listed.
Jingyi Guo Fuglstad, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Fluorescent signal from the virus was amplified by immunostaining against Red Fluorescent Protein (RFP) (catalog no.5F8, Chromotek GmbH, Germany), followed by secondary antibody-staining with Alexa 546-tagged Goat Anti-rat IgG (catalog no ...
-
No products found
because this supplier's products are not listed.
Melissa H. Bergeman, et al.,
bioRxiv - Microbiology 2023
Quote:
... Image segmentation and 3D rendering of HSV-1 virus particle undergoing exocytosis from Rab6a vesicle was done in Imaris (Oxford Instruments) by constructing spots and surfaces for the objects at respective image slices ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Erica J. Polleys, et al.,
bioRxiv - Genetics 2022
Quote:
... or a-Rad51 (3 uG; Agrisera AS07 214) for 2 hours at 4°C ...
-
No products found
because this supplier's products are not listed.
Pranay Shah, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 3 μM of CHIR99021 (Cambridge Bioscience, SM13-5) and 10 μM of Y-27632 ...
-
No products found
because this supplier's products are not listed.
Vladimir Girik, et al.,
bioRxiv - Cell Biology 2023
Quote:
3 μm carboxyl polystyrene beads (Spherotech, CP30-10) were covalently coupled with purified human IgG (hIgG ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Alisa Fox, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were washed and incubated in Accutase cell detachment solution for 10 min at room temperature to gently remove any surface-bound virus while preserving epitopes for flow cytometry analysis (Innovative Cell Technologies; as described in (39)) ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...