-
No products found
because this supplier's products are not listed.
Kristin S. Fitzpatrick, et al.,
bioRxiv - Immunology 2022
Quote:
... and Vaccinia virus B8R (TSYKFESV, Biomatik).
-
No products found
because this supplier's products are not listed.
Luciana Galetto, et al.,
bioRxiv - Microbiology 2020
Quote:
... together with 3 μL of Sharpmass VI Prestained Protein Marker (EuroClone) and 5 μL of Unstained SDS-PAGE Standards ...
-
Recombinant Human BMP2 protein was expressed in Escherichia coli.
Cat# BMP2-01H,
50ug , USD $298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Lauren J. Lahey, et al.,
bioRxiv - Biochemistry 2020
Quote:
HEK293 cell lines were seeded in PurCol-coated (Advanced BioMatrix) 6-well plates at 300,000 total cells in 2 mL media one day before transfection ...
-
No products found
because this supplier's products are not listed.
Wassim Eid, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rabbit polyconal to 14-3-3 (SA-483, Biomol); rabbit polyconal to CHK1-pS345 (2348S ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Avirup Malla, Suvroma Gupta, Runa Sur,
bioRxiv - Cancer Biology 2023
Quote:
... Caspase 3 activity was measured by a caspase-3 activity assay kit (Elabscience) following the manufacturer’s instructions.
-
LC Laboratories' Product Number R-8200 - Ribociclib, Free Base (Lee011, CAS 1211441-98-3), >99%...
Cat# R-8200, SKU# R-8200_100mg,
100 mg, $127.00
Ask
Rohan N. Shah, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3 µM CHIR99021 (LC Laboratories), 1 µM PD0325901 (LC Laboratories) ...
-
No products found
because this supplier's products are not listed.
Qian Zhou, et al.,
bioRxiv - Neuroscience 2021
Quote:
We delivered ∼150 nl of AAV virus with a stereotaxic instrument (David Kopf Instruments, #PF-3983; RWD Life Science, #68030) and a pressure micro-injector (Nanoject II ...
-
No products found
because this supplier's products are not listed.
Brenton T. Laing, et al.,
bioRxiv - Neuroscience 2022
Quote:
Immunostaining was conducted for axonal projections and verification of virus expression using a chicken anti-GFP polyclonal antibody (1:1000, Cat # GFP-1020, RRID:AB_10000240; Aves Labs, CA, U.S.A.) or a rabbit anti-DsRed polyclonal antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Melissa H. Bergeman, et al.,
bioRxiv - Microbiology 2023
Quote:
... Image segmentation and 3D rendering of HSV-1 virus particle undergoing exocytosis from Rab6a vesicle was done in Imaris (Oxford Instruments) by constructing spots and surfaces for the objects at respective image slices ...
-
No products found
because this supplier's products are not listed.
Vidur Garg, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and 3 µM GSK3βi/CHIR99021 (Reprocell) (‘AGi’ media ...
-
No products found
because this supplier's products are not listed.
Tiesuo Zhao, et al.,
bioRxiv - Immunology 2024
Quote:
... cleaved-caspase 3 (1:1000, Bioworld), Pro-Caspase 3 (1:2000 ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Minhui Guan, et al.,
bioRxiv - Microbiology 2024
Quote:
... Each test virus was diluted to a final concentration of 100 pM with 1 × kinetic buffer containing 10 µM oseltamivir carboxylate (American Radiolabeled Chemicals, St. Louis, MO) and zanamivir (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Astrid Kollewe, et al.,
bioRxiv - Biochemistry 2021
Quote:
... manually packed 11 cm (AP-MS) or 23 cm (csBN-MS) with ReproSil-Pur 120 ODS-3 (C18; particle size 3 µm; Dr. Maisch HPLC, Germany) and electrosprayed (2.3 kV ...
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Teri N. Hreha, et al.,
bioRxiv - Immunology 2023
Quote:
... O and K serotypes (1:200, Meridian Life Science #B65109G), Rat anti-Ly6G-APC (1:200 ...
-
No products found
because this supplier's products are not listed.
Simon J. Cleary, et al.,
bioRxiv - Immunology 2024
Quote:
... These sequences were codon-optimized and antibodies were expressed as chimeric hIgG1 with or without Fc point mutations in a HEK293 cell system and purified using protein A and buffer exchange (Absolute Antibody).
-
No products found
because this supplier's products are not listed.
Kranti Konganti, et al.,
bioRxiv - Genomics 2023
Quote:
... and serotype identification was determined following previously published protocols (Fitzgerald et al., 2007; McQuiston et al., 2011).
-
No products found
because this supplier's products are not listed.
Marisol Sampedro-Castañeda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti Cav2.3 N-terminus 1:250 (Covalab, custom 1, HEK293 & brain), rabbit anti pS15 Cav2.3 1:500 (Covalab ...
-
No products found
because this supplier's products are not listed.
Alexander B. Coley, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human embryonic kidney (HEK293) cell line was obtained from GenLantis (San Diego, CA) and cultured in MEM (Mediatech ...
-
No products found
because this supplier's products are not listed.
Martina Oravcová, et al.,
bioRxiv - Cell Biology 2022
Quote:
Endogenous level of DNA damage in HEK293 cells was evaluated using the CometAssay kit (Trevigen) according the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Silvia De Cicco, et al.,
bioRxiv - Neuroscience 2020
Quote:
NFAT Reporter - HEK293 Cell Line (PKC/ Ca2+ Pathway) cell lines were purchased from Tebu-Bio and cultured in Dulbecco’s MEM (Merck ...
-
No products found
because this supplier's products are not listed.
Sylvie Roy, et al.,
bioRxiv - Microbiology 2020
Quote:
... the media was replaced with serum-free media (SFM) BalanCD HEK293 (Fujifilm Irvine Scientific, Santa Ana, CA). The next day ...
-
No products found
because this supplier's products are not listed.
Sahiti Kuppa, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 180 μl of either fluorescent protein was added to a 3 mm path length quartz cuvette (Starna Cells Inc.) and maintained at 23 °C in a PC1 spectrofluorometer (ISS Inc.) ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Katrin Manske, et al.,
bioRxiv - Bioengineering 2023
Quote:
20,000 Human Embryonic Kidney cells (HEK293-CD19+) expressing the CD19 antigen were seeded on a 96-well E-plate (ACEA Biosciences) over night ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Emilia Neuwirt, et al.,
bioRxiv - Immunology 2022
Quote:
... 3 - 5 μM MCC950 (Adipogen), 50 - 200 nM MG132 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Janhavi Prasad Natekar, et al.,
bioRxiv - Microbiology 2022
Quote:
Tissues harvested from virus-inoculated animals were weighed and homogenized in a bullet blender (Next Advance, Averill Park, NY, USA) using stainless steel or zirconium beads ...
-
No products found
because this supplier's products are not listed.
Susanne Wiemann, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3 % goat serum (Dianova, Hamburg, Germany), and 0.5 % Triton™-X-100 (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Anna Zhuravskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3 µM CHIR99021 (Cambridge Bioscience, cat# SM13-1), 0.5 mM L-Glutamine (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
Ugo Dionne, et al.,
bioRxiv - Systems Biology 2020
Quote:
... prey strains are each expressing a gene of interest fused at its 3’ end to the DHFR F[3] and are resistant to hygromycin B (HPH 250 μg/ml, Bioshop Canada). The same BY4741 strains were used in the growth assays with the addition of knockout (KO ...
-
No products found
because this supplier's products are not listed.
Isadora Matias, et al.,
bioRxiv - Neuroscience 2021
Quote:
Protein concentration in cell extracts was measured by the BCA Protein Assay Kit (Cole-Parmer). Forty micrograms protein/lane was electrophoretically separated on a 10% SDS polyacrylamide gel and electrically transferred onto a Hybond-P PVDF transfer membrane (Millipore ...
-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Alisa Fox, et al.,
bioRxiv - Immunology 2021
Quote:
... cells were washed and incubated in Accutase cell detachment solution for 10 min at room temperature to gently remove any surface-bound virus while preserving epitopes for flow cytometry analysis (Innovative Cell Technologies; as described in (39)) ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Yann Aquino, et al.,
bioRxiv - Genomics 2022
Quote:
... Recombinant IFN-χ protein (PBL Assay Science) was used as a calibrator ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Patrik Risteski, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and human anti-centromere protein antibody (Antibodies Incorporated). The secondary antibodies used were donkey anti-mouse IgG-Alexa Fluor 488 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Michael Korenkov, et al.,
bioRxiv - Immunology 2023
Quote:
For protein complexes crystallization we used a mosquito crystallization robot (TTP Labtech) to set vapor diffusion sitting drops with 96-well iQ plates (TTP Labtech) ...