-
No products found
because this supplier's products are not listed.
Lyra O. Randzavola, et al.,
bioRxiv - Immunology 2022
Quote:
... HEK293-F were transfected with polyethylenimine (Polyscience Europe GmbH) at a ratio of 1:3 DNA:polyethylenimine (Tom et al. ...
-
No products found
because this supplier's products are not listed.
Susanna R. Bidgood, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1% FCS for 30 min and immune-stained with anti-GFP nanobody (Chromotek) conjugated in-house to AlexaFluor647-NHS (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Joseph Hiatt, et al.,
bioRxiv - Genetics 2020
Quote:
... 1% Human AB Serum (Valley Biomedical HP1022HI), Penicillin-Streptomycin (100IU and 100µg/mL ...
-
No products found
because this supplier's products are not listed.
Charlie J. Childs, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human Fibrinogen 1 Plasminogen Depleted (Enzyme Research Lab Cat#FIB-1), and X-Vivo 20 (Lonza Cat#190995) ...
-
No products found
because this supplier's products are not listed.
Oktawia Nilsson, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and cholesterol (FC) (Avanti Polar Lipids) were dissolved in 3:1 chloroform:methanol ...
-
No products found
because this supplier's products are not listed.
Mukundan Attur, et al.,
bioRxiv - Cell Biology 2019
Quote:
... supplemented with 10% FCS (Atlanta Biologicals). Cells at 50-70% confluency were transfected by overnight incubation with the indicated cDNAs in complete growth medium using TransIT®-LT1 - Transfection Reagent according to the manufacturer’s instructions (Mirus Bio ...
-
No products found
because this supplier's products are not listed.
Damian Dudka, R. Brian Akins, Michael A. Lampson,
bioRxiv - Cell Biology 2023
Quote:
... Centromeres were labeled with CREST (human anti-human Anti-Centromere Antibody, 1:200, Immunovision, HCT-0100) and an Alexa Fluor 594–conjugated goat anti-human secondary antibody (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Marcel Lagedroste, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Membranes were solubilized with 1% (w/v) of the lipid-like detergents FC-16 (Anatrace) for 1 h at 8°C ...
-
No products found
because this supplier's products are not listed.
Naoya Kase, et al.,
bioRxiv - Immunology 2020
Quote:
... and the Human CCL2 (MCP-1) Kit (62HCCL2PEG; Cisbio) or Human CXCL10 (IP-10 ...
-
No products found
because this supplier's products are not listed.
David Beck, et al.,
bioRxiv - Genetics 2020
Quote:
... supplemented with 10% FCS (Gemini Bio-Products) and 1× antibiotics (Life Technologies) ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Evangelos Stefanidis, et al.,
bioRxiv - Bioengineering 2023
Quote:
... 1% Penicillin/Streptomycin and 50ng/ml human M-CSF (ImmunoTools) for 7 days and harvesting the adherent fraction ...
-
No products found
because this supplier's products are not listed.
Scott P. Davies, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... supplemented with 10% fetal calf serum (FCS, EuroClone) (complete medium) ...
-
No products found
because this supplier's products are not listed.
Kevin P. Foley, et al.,
bioRxiv - Physiology 2020
Quote:
... Human insulin (Mercodia) and human C-peptide (Millipore ...
-
No products found
because this supplier's products are not listed.
Dennis J. Doorduijn, et al.,
bioRxiv - Microbiology 2021
Quote:
... for C5b6 with 1:500 dilution of goat-anti human C5 serum (Complement Technology) and for sMAC with 1 µg/ml biotinylated monoclonal anti-C7 (clone F10 ...
-
No products found
because this supplier's products are not listed.
David Knupp, et al.,
bioRxiv - Genomics 2021
Quote:
... 100μg total RNA from cortex or cultured HEK293 cells was treated with or without 1μL of RNaseR [20 U/μl] (Lucigen), plus 1.9μL RNaseOUT [40 U/μL] (ThermoFisher Scientific ...
-
The original balance of enzymatic activities. Each lot assayed for collagenase, caseinase,...
Cat# LS004194,
100 mg, $42.00
Ask
Marco Bauzá-Thorbrügge, et al.,
bioRxiv - Physiology 2022
Quote:
Human adipocytes were isolated from adipose tissue samples by collagenase (type 1, Worthington, NJ, USA) as described previously [24] ...
-
No products found
because this supplier's products are not listed.
Trine Lisberg Toft-Bertelsen, et al.,
bioRxiv - Neuroscience 2022
Quote:
... or humans (MBS707296, MyBioSource). The CSF samples were added to wells pre-coated with LPA antibody ...
-
No products found
because this supplier's products are not listed.
Niko Schwenzer, et al.,
bioRxiv - Cell Biology 2024
Quote:
HEK293 cells with constitutive expression of CaV subunits β3 and α2δ1 and inducible expression of α1D (Charles River Laboratories CT6232) were cultured in DMEM/F12 medium containing selection antibiotics and 0.6 µM isradipine (Sigma I6658) ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
Recombinant Human CD19 Protein, With C-Fc Tag (rh CD19 Fc Chimera) Pro 20 - Lys 291 (Accession #...
Cat# CD19-3308H,
10ug , USD $198
Ask
Sunil Yeruva, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Recombinant protein of human DSG2 tagged with IgG Fc domain (Fc) (Creative Biomart; #DSG2-1601H) and N-CAD-Fc (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Azide-free human IgG-Fc was purchased from Athens Research and Technology (Athens ...
-
No products found
because this supplier's products are not listed.
Pehuén Pereyra Gerber, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated for 30 min with a PE-labeled anti–human IgG-Fc antibody (Leinco/Biotrend), washed again ...
-
No products found
because this supplier's products are not listed.
Bjoern Traenkle, et al.,
bioRxiv - Immunology 2021
Quote:
... an alpaca (Vicugna pacos) was immunized with the purified extracellular domains of human CD4 (aa26-390) recombinantly produced in HEK293 cells (antibodies-online GmbH, Germany). After initial priming with 1 mg ...
-
No products found
because this supplier's products are not listed.
Maali AlAhmad, et al.,
bioRxiv - Cell Biology 2024
Quote:
... HEK293-TRPM2tet cells grown in 96-well plates (Sarstedt) were preloaded with 1 µM Fura-2-AM/ 0.02% Pluronic® F127 (P-3000MP ...
-
No products found
because this supplier's products are not listed.
José A. González-Feliciano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The 2G12 and PG16 bNAbs in 0.5X Kinetics Buffer (PBS with 0.02% Tween and 0.05 mg/mL BSA) were loaded onto an anti-Human IgG Fc Capture sensor (Pall ForteBio Corp). Binding kinetics were determined using serial dilutions of CHO-K1-produced and Expi293F-produced gp145 ...
-
This tropoelastin is produced using recombinant production methods. The tropoelastin is supplied...
Cat# 5052-1MG,
1 mg, USD $375.0
Ask
Ines A Cadena, et al.,
bioRxiv - Bioengineering 2024
Quote:
... human (1 mg/mL, Advanced Biomatrix) and either GelMA (8.7% v/w ...
-
Cat# HY-P70101-10 μg,
10 μg, USD $104.0
Ask
Huan Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Teriparatide (Human parathyroid hormone-(1-34)) (MedChemExpress), Glu (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Martin H. Berryer, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti-human SLC1A3 (1:500, Boster, PA2185), Rabbit anti-human S100b (1:200 ...
-
No products found
because this supplier's products are not listed.
Alexandru-Ioan Voda, et al.,
bioRxiv - Genomics 2023
Quote:
... Human Anti-CD27 agonist antibody (100111-1, AMSBio) and Mouse Anti-CD6 agonist antibody (Clone UMCD6 ...
-
No products found
because this supplier's products are not listed.
Cheyenne Hurst, et al.,
bioRxiv - Neuroscience 2022
Quote:
... recombinant human Aβ42 (5 μM) (rPeptide, # A-1170-1) was handled essentially as described (67 ...
-
No products found
because this supplier's products are not listed.
C. Maresca, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 50 units of purified human PARP-1 (High Specific Activity hPARP-1, Trevigen) were incubated in a mixture containing 100 mM Tris-HCl pH 8 ...
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Ling Ning Lam, et al.,
bioRxiv - Microbiology 2021
Quote:
... and inoculated at a ratio of 1:1000 into pooled human serum or pooled human urine (both purchased from Lee Biosolutions). At selected time points ...
-
No products found
because this supplier's products are not listed.
Vasudha Tandon, et al.,
bioRxiv - Biochemistry 2021
Quote:
... total RNA from HEK293 cells were isolated using the NucleoSpin RNA kit (Macherey-Nagel, Bethlehem, PA). cDNA was synthesized using the iScript kit (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Chung-Ling Lu, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Anti-human procollagen type 1 antibody (LF68, ENH018) was purchased from Kerafast Inc ...
-
No products found
because this supplier's products are not listed.
Gunsagar S. Gulati, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Cells were Fc-blocked with of rat IgG (LifeSpan BioSciences) and stained with 5 μg/ml of rat anti-mouse antibodies (catalog no. ...
-
No products found
because this supplier's products are not listed.
Siyi Gu, et al.,
bioRxiv - Cell Biology 2023
Quote:
HEK293 cells expressing Flag-SNAP-CCR5 were seeded onto 10-mm glass-bottom dishes (FluoroDish, FD3510, WPI) previously coated with 5 μg/ml fibronectin ...
-
No products found
because this supplier's products are not listed.
Erin A. Stephens, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 50 μM human ubiquitin (Boston Biochem), 4 mM ATP and 1 mM DTT in 20 mM MOPs ...
-
No products found
because this supplier's products are not listed.
Damon A. Hofman, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human EGF (20ng/mL; Shenandoah Biotech), human FGF-basic-154 (20ng/mL ...
-
No products found
because this supplier's products are not listed.
Lisha Zha, et al.,
bioRxiv - Immunology 2021
Quote:
... RBD was cleaved from the Fc part using thrombin(Beijing Solarbio Science & Technology Co., Ltd.) as described in the manufacturer’s manual.
-
No products found
because this supplier's products are not listed.
S. Jordan Kerns, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Human alveolar epithelial cells (Cell Biologics, Accegen) were cultured using SABM medium (Lonza ...
-
PRG-1 (EDTA -dPBS Solution) prepares the cells for PRG-2 (containing Trypsin) processing. Cell...
Cat# 4Z0-610,
100.0 mL, $68.0
Ask
Changsheng Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human umbilical vein endothelial cells (HUVECs, Cell System) were cultured in endothelial cell growth medium according to the protocol provided by the manufacturer (VascuLife ...
-
No products found
because this supplier's products are not listed.
Xindi Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-human IBA1 (Aves Labs, IBA1-0020), mouse anti-human TMEM119 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Liangbo Qi, et al.,
bioRxiv - Biophysics 2019
Quote:
... 3.5 μl aliquots of the recombinant human TIM22 complex (7 mg ml-1) were dropped onto glow discharged holey carbon grids (Quantifoil Au R1.2/1.3, 300 mesh), blotted with a Vitrobot Mark IV (ThemoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Lucia Gonzalo, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and DCL-1 (Agrisera, diluted 1:100). For the localization of RNAPII we used antibodies recognizing RNAPII phosphorylated at serine 5 (Chromotek ...
-
No products found
because this supplier's products are not listed.
Christian Franke, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Immunostaining of specific receptors was performed by incubating cells overnight with AlexaFluor 647 conjugated primary antibodies (human CD4: OKT4, dilution: 1:100, source: Biolegend; human CD45: MEM-28, dilution: 1:2000, source: ExBio) diluted in Blocking solution ...
-
No products found
because this supplier's products are not listed.
Jan Clement Santiago, et al.,
bioRxiv - Microbiology 2020
Quote:
... 1 ng human genomic DNA (Bioline, Cat. # BIO-35025) was used as negative control ...
-
No products found
because this supplier's products are not listed.
Sunghan Jung, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Anti-Human sAPPbeta (Tecan (IBL), JP18957) ...
-
No products found
because this supplier's products are not listed.
Zintis Inde, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human tissue microarrays were obtained from US Biomax, Inc ...