-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Nigel Dao, Dakota F. Brockway, Nicole A. Crowley,
bioRxiv - Neuroscience 2019
Quote:
... 3×50 uL of the aCSF within the well was pipetted into a 96-well SST ELISA plate (Peninsula Labs, cat. #S-1179) as per the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Zelin Liu, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... second-strand cDNAs were synthesized using P2-T24 (5’-ATATCTCGAGGGCGCGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT-3’) by I-5 High-Fidelity DNA polymerase (MCLAB) at 98°C for 2 min ...
-
No products found
because this supplier's products are not listed.
Ying Chang, et al.,
bioRxiv - Genetics 2023
Quote:
... Genomic DNA isolation kit (Biomiga, BW-GD2211-02) was used to extract genomic DNA from placental tissue and HTR8/SVneo cells in the following experiments ...
-
No products found
because this supplier's products are not listed.
Julian Gurgo, et al.,
bioRxiv - Genetics 2022
Quote:
... P720) coupled to an eight-way valve (HVXM 8-5, Hamilton) delivers the buffers into a FCS2 flow chamber (Bioptechs). Barcodes were injected sequentially using a homemade delivery platform composed of a rotating tray where the tubes are arranged (Physik Instrumente ...
-
No products found
because this supplier's products are not listed.
Maggie R. Wagner, et al.,
bioRxiv - Plant Biology 2019
Quote:
... We extracted DNA using the Synergy 2.0 Plant DNA Extraction Kit (OPS Diagnostics, Lebanon, NJ, USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Joseph I Aubee, et al.,
bioRxiv - Microbiology 2024
Quote:
... Genomic DNA used for PCR reactions was isolated using The Column-PureTM Bacterial Genomic DNA Kit (Lamda Biotech), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Hongkui Xiao, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were read for absorbance at 405 nm (TriStar plate reader). Resulting data were plotted as concentration (x axis ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Xing Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 5 x 10-5 M DL-AP5 (DL-2-amino-5-phosphonopentanoic acid, BN0086, Biotrend), and 10-5 M CNQX (6-cyano-7-nitroquinoxaline-2,3-dione ...
-
No products found
because this supplier's products are not listed.
Eric Waltari, et al.,
bioRxiv - Immunology 2019
Quote:
... The 384-well source plate (Scienion) was kept at dewpoint ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Banneville, et al.,
bioRxiv - Microbiology 2021
Quote:
200 ng of relaxed DNA (relaxed pHOT-1 DNA, 2.4 kb) (Topogen) was incubated for 15 min at 4°C in the absence or presence of increasing concentrations of DdrC in 25 μl of buffer composed of 40 mM Tris-HCl pH7.8 ...
-
No products found
because this supplier's products are not listed.
K Seto, TY James,
bioRxiv - Evolutionary Biology 2023
Quote:
... were inoculated onto 20 plates of WC medium (1% agar) and each plate was sealed with Parafilm M laboratory film (Bemis). After 3 days of incubation at 20 °C and under LED lighting ...
-
No products found
because this supplier's products are not listed.
Alexandra Maslennikova, et al.,
bioRxiv - Microbiology 2021
Quote:
... Taq DNA polymerase (SibEnzyme, Russia) and primers listed at the end of Table S2 ...
-
No products found
because this supplier's products are not listed.
Javier Emperador-Melero, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 5% Fetal Select bovine serum (Atlas Biologicals), 2% B-27 supplement ...
-
No products found
because this supplier's products are not listed.
Teisha J. Rowland, et al.,
bioRxiv - Cancer Biology 2019
Quote:
DNA FISH (Empire Genomics, #TERT-20-OR) of all cell lines and karyotyping of LN-18 cells was performed by the WiCell Research Institute Characterization Laboratory.
-
No products found
because this supplier's products are not listed.
Tomoki Takeda, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Rats (8 weeks old) were administered a single intratracheal dose of clodronate liposome or control liposome (LIPOSOMA, Inc., Amsterdam, The Netherlands) at a dose of 1 ml/kg ...
-
No products found
because this supplier's products are not listed.
Trayambak Pathak, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Then the plate was kept in YSI 7100 multichannel biochemistry analyzer (YSI Life Sciences), to measure glucose and lactate levels in the media ...
-
No products found
because this supplier's products are not listed.
Madison Goforth, et al.,
bioRxiv - Microbiology 2023
Quote:
... 1.25 µL of mPNA blocker (5 µM; mitochondria blockers; PNA Bio), 1.25 µL of pPNA blocker (5 µM ...
-
No products found
because this supplier's products are not listed.
Hisayoshi Kubota, et al.,
bioRxiv - Neuroscience 2022
Quote:
... sections were blocked with 5% fetal bovine serum (Nichirei Bioscience Inc., Tokyo, Japan) in PBST for 2 h and then incubated with primary antibodies in PBST at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Bethany A. Stahl, James B. Jaggard, Alex C. Keene,
bioRxiv - Neuroscience 2019
Quote:
Axotomized and intact control flies were sleep-deprived in groups of 8–10 flies in housing vials mounted on a vortexer (Scientific Industries, Inc, Vortex Genie 2, #SI-0236). Mechanical shaking stimulus was applied using a repeat-cycle relay switch (Macromatic ...
-
No products found
because this supplier's products are not listed.
Benjamin Ng, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using the Quickzyme Total Collagen assay kit (Quickzyme Biosciences).
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... resuspended proteins were PEGylated for 1 hr at RT to label newly exposed cysteine thiols with the 5 kDa mass tag reagent (mPEG-5k, Badrilla SiteCounter™). Approximately 20 μl of each supernatant was saved as the “total input.” For immunoblot analysis ...
-
No products found
because this supplier's products are not listed.
Osvaldo Contreras, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Notexin muscle damage was induced by intramuscular injection of 0.15 μg notexin snake venom (Latoxan) into the TA muscle (Contreras et al. ...
-
No products found
because this supplier's products are not listed.
Steven J. Grzegorski, et al.,
bioRxiv - Genetics 2019
Quote:
... Prothrombin levels in the expression media and the cell lysate were then quantified by ELISA using a matched-pair antibody set ELISA kit (Affinity Biologicals Inc.; FII-EIA).
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Valentin Mitterer, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Growth phenotypes of the mutant alleles were analysed on plates containing 1 g/l 5-fluoroorotic acid (5-FOA) (Apollo Scientific, Cat# PC4054) to select for cells that have lost the wild-type SPB4-containing URA3 plasmid ...
-
No products found
because this supplier's products are not listed.
Jeremy Garb, et al.,
bioRxiv - Microbiology 2021
Quote:
... from the genomic DNA of Geobacter sulfurreducens Caccavo (LGC Standards cat #51573D-5). The resulting DNA fragment was digested by Eco31I (ThermoFisher cat #FD0293 ...
-
GSK-3β inhibitor
Sold for research purposes only.
Cat# 2010.0, SKU# 2010-10 mg,
10mg, US $99.00 / EA, EURO, €90 / EA
Ask
Nadine Weinelt, et al.,
bioRxiv - Cell Biology 2022
Quote:
... HOIPIN-8 from Axon Medchem LLC (Reston ...
-
No products found
because this supplier's products are not listed.
Ronald Rodriguez, et al.,
bioRxiv - Microbiology 2022
Quote:
... and AMK (Ambeed, 8 μg/ml). All cultures were prepared in triplicate ...
-
No products found
because this supplier's products are not listed.
Jessica Nowacki, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... pH 8) using a Celldisrupter TS 0.75 (Constant Systems) at 1350 bar.
-
No products found
because this supplier's products are not listed.
Sara Abdulkader, John Gigg,
bioRxiv - Animal Behavior and Cognition 2024
Quote:
Training took place in 8 operant chambers (Campden instruments Ltd, UK), each placed inside a ventilated and sound-attenuating box ...
-
No products found
because this supplier's products are not listed.
Hai Li, et al.,
bioRxiv - Biophysics 2021
Quote:
... and IMISX™ plates (MiTeGen) which are designed to perform in meso in situ serial X-ray crystallography (Huang et al. ...
-
No products found
because this supplier's products are not listed.
Anna Skåne, et al.,
bioRxiv - Biochemistry 2021
Quote:
Residual genomic DNA (gDNA) was removed using The Heat&Run gDNA removal kit (ArcticZymes®, Tromsø, Norway). 8 µL of the RNA samples was transferred to a RNase free Eppendorf tube on ice ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
S. Hong Chan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
David E Ehrlich, David Schoppik,
bioRxiv - Neuroscience 2019
Quote:
Supplemental videos at high spatial resolution were alternatively filmed in a thinner glass tank (96/G/5 24×5×5 mm, Starna Cells, Inc.) using a Sony IMX174 CMOS chip (ace acA1920-155um ...
-
No products found
because this supplier's products are not listed.
Jugal Mohapatra, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Oakwood Chemical)/Oxyma (5 eq, Oakwood Chemical) and heated to 90 °C for 2 min while bubbling with nitrogen gas in N,N-dimethylformamide (DMF ...
-
No products found
because this supplier's products are not listed.
Diana Cortes-Selva, et al.,
bioRxiv - Immunology 2020
Quote:
... plates were coated with 2μg/mL tetanus (List Labs), diphtheria (Sigma) ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
No products found
because this supplier's products are not listed.
Ke Hou, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with a R-AXIS HTC imaging plate detector (Rigaku). Cu K-α x-ray beam with 1.5406 Å wavelength was used ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Karl Kochanowski, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Plates were sealed with BreathEasy foil (Neta Scientific, CAT RPI-248738) to minimize evaporation and incubated at 37C with 5% CO2 for 16-20h before starting the time lapse microscopy experiments to allow cells to adhere to the plate bottom.
-
No products found
because this supplier's products are not listed.
Qijing Xie, et al.,
bioRxiv - Neuroscience 2021
Quote:
... brains were then incubated in rat anti-Ncad (N-Ex #8; 1:40; Developmental Studies Hybridoma Bank) and chicken anti-GFP (1:1000; Aves Labs) diluted in 5% normal goat serum in PBST for two overnights on a 4°C nutator ...