-
No products found
because this supplier's products are not listed.
Rui Xiao, et al.,
bioRxiv - Physiology 2019
Quote:
... PCR probe for Cela1 (chymotrypsin-like elastase family, member 1) was purchased from ThermoFisher (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
Sophie A. Harrington, et al.,
bioRxiv - Plant Biology 2019
Quote:
... in this case TraesCS1D01G436500 (Sigma 70-like family) and TraesCS4B01G383400 (HSF family) ...
-
No products found
because this supplier's products are not listed.
Jiawan Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and GTP-bound RAS was quantified using active RAS detection kit (# 8821) from Cell Signaling Technology according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Miles A. Keats, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... the RAS-GTP pull-down assay kit (Cytoskeleton #BK008) was used ...
-
No products found
because this supplier's products are not listed.
Antonio Cuevas-Navarro, et al.,
bioRxiv - Biochemistry 2022
Quote:
... and pan-RAS (ab108602; 1:1000) antibodies were from Abcam. KRAS (WH0003845M1 ...
-
No products found
because this supplier's products are not listed.
Tim Rick, et al.,
bioRxiv - Microbiology 2021
Quote:
To verify the functionality of mutated SoGGDEF proteins they were tested for GTP binding using MANT-GTP (Jena Bioscience, Germany). Proteins were diluted to 1 μM and 100 μl of each sample was added in triplicates into a white round bottom 96-well plate before MANT-GTP with a final concentration of 1 μM was added ...
-
No products found
because this supplier's products are not listed.
Ibrahim M. Sabbarini, et al.,
bioRxiv - Biochemistry 2024
Quote:
... sensors were moved into binding buffer with 1 mM GTP (Roche), 1 mM XTP (TriLink Biotechnologies) ...
-
No products found
because this supplier's products are not listed.
Andrea Wetzel, et al.,
bioRxiv - Neuroscience 2023
Quote:
... TCF/LEF family antibody sampler kit (New England BioLabs), NFAT1 (New England BioLabs) ...
-
No products found
because this supplier's products are not listed.
Christian W. Johnson, et al.,
bioRxiv - Biochemistry 2023
Quote:
... GDP-bound RAS (5µM) was preloaded with 32P-γ-GTP (50nM) from Perkin Elmer, for 5 minutes in exchange buffer (20 mM Tris ...
-
No products found
because this supplier's products are not listed.
Moon Hee Yang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and immunoblotting was performed to detected GTP-bound Ras proteins using anti-K-Ras antibody (Proteintech, 12063-1-AP), anti-RasG12D mutant specific antibody (Cell Signaling Technologies [CST] ...
-
No products found
because this supplier's products are not listed.
Kelly E. Leon, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Anti Ras (BD Transduction Laboratories ...
-
No products found
because this supplier's products are not listed.
Richard Lieberman, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and insulin-like growth factor 1 (IGF-1, Peprotech). All cells were incubated at 37° in 5% CO2.
-
No products found
because this supplier's products are not listed.
Christina Pressl, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Solute Carrier Family 1 Member 3 (SLC1A3, Santa Cruz sc-515839 used at a concentration of 1:2000) ...
-
No products found
because this supplier's products are not listed.
Karl P. Schlingmann, et al.,
bioRxiv - Genetics 2021
Quote:
... Ras-related GTP binding D (Rragd) (forward, CACCTGAGCTTTTACCTGA; reverse, TCAGCAGATTCTCCAGCGTC) gene expression levels were quantified by SYBR-Green (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Edurne Mugarza, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Pan-RAS antibody was obtained from Merck Millipore (MABS195) ...
-
No products found
because this supplier's products are not listed.
Woojong Lee, et al.,
bioRxiv - Immunology 2020
Quote:
... Trypsin-Like and Caspase-Like Cell-Based Assays (Promega), according to manufacturer’s instructions (Moravec et al. ...
-
No products found
because this supplier's products are not listed.
Richard Janissen, et al.,
bioRxiv - Biophysics 2021
Quote:
... GTP (GE Healthcare Europe), and 100 µM ApU (IBA Lifesciences GmbH ...
-
No products found
because this supplier's products are not listed.
R. G. Langston, et al.,
bioRxiv - Neuroscience 2021
Quote:
... targeting LRRK2 sequence near GTP binding and ATP kinase binding domains were synthesized and cloned into pSpCas9(BB)-2A-GFP plasmid (Addgene #48138). Plasmids were transfected into A18945 iPSC line using Lipofectamine-Stem transfection reagent (ThermoFisher #STEM00001 ...
-
No products found
because this supplier's products are not listed.
Zhen Li, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and insulin-like growth factor-1 (IGF-1, R&D systems) were supplemented to the media changes for 10 days ...
-
No products found
because this supplier's products are not listed.
Luke Grundy, et al.,
bioRxiv - Neuroscience 2020
Quote:
... to prevent non-specific binding was followed by a 1-hour incubation in primary antibody (pERK; 1:800) in Antibody Diluent (S0809, Agilent DAKO). Following removal of excess primary antibody with wash buffer ...
-
No products found
because this supplier's products are not listed.
Lorenz Thurner, et al.,
bioRxiv - Immunology 2021
Quote:
... rabbit IL-1-Ra antibody (antibodies-online # ABIN2856394) followed by anti rabbit/POX 1:3000 (Biorad#170-6515) ...
-
No products found
because this supplier's products are not listed.
Grant D. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Affinity-purified rabbit polyclonal antibodies specific to each eIF4E family member (Genscript) were used as the primary probe in western blotting ...
-
No products found
because this supplier's products are not listed.
Manukumar Honnayakanahalli Marichannegowda, et al.,
bioRxiv - Microbiology 2020
Quote:
HIV-1 specific binding antibody titers were performed by coating high-binding 384 well plates (Corning, Corning, NY) overnight at 4°C with 1086C and Con6 gp120s ...
-
No products found
because this supplier's products are not listed.
Nandan S. Gokhale, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Following binding of horseradish peroxidase conjugated secondary antibody (1:1000; Jackson ImmunoResearch), infected foci were visualized with the VIP Peroxidase Substrate Kit (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Rebecca L Wilson, et al.,
bioRxiv - Physiology 2021
Quote:
... Antibody binding was then amplified by incubating with goat anti-rabbit secondary antibody (1:200, Vector Laboratories), followed by incubation with the ABC reagent (Vector Laboratories) ...
-
No products found
because this supplier's products are not listed.
Farshad Farshidfar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
The amount of GTP-bound RAS was determined using the Ras GTPase Chemi ELISA Kit (Active Motif North America ...
-
No products found
because this supplier's products are not listed.
Travis J Gates, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primary antibodies binding markers: CD81 (cat# 104902, Biolegend 1:1000), and ALIX (cat# 634502 ...
-
No products found
because this supplier's products are not listed.
Caitlin A. Loh, et al.,
bioRxiv - Genomics 2023
Quote:
... Genomic DNA for Family 1100 and Family 2100 was extracted with the MagAttract HMW DNA Kit (Qiagen) from whole blood samples of individuals enrolled in a human subjects research protocol approved by the New York University Grossman School of Medicine Institutional Review Board.
-
No products found
because this supplier's products are not listed.
Lu Han, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... 2uM RA+ 2uM PMA (Tocris) is used for 2 days ...
-
No products found
because this supplier's products are not listed.
Jeremy R. Egbert, et al.,
bioRxiv - Cell Biology 2019
Quote:
... antibody binding was detected using fluorescent secondary antibodies (LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
Caroline Wiser, et al.,
bioRxiv - Immunology 2020
Quote:
... Human THP-1 monocyte-like cells (THP-1 Lucia ISG, Invivogen) were maintained in RPMI 1640(Thermo Fisher cat ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... then 1 µM all-trans retinoic acid (RA, STEMCELL Technologies, 72262) and 100ng/mL human recombinant Fibroblast Growth Factor 2 (FGF2 ...
-
No products found
because this supplier's products are not listed.
Simon J Moore, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... low-binding plate (Greiner). Reactions were measured as a triplicate technical repeat and at least repeated with cell-extracts prepared from two separate days ...
-
No products found
because this supplier's products are not listed.
Sameer Farouk Sait, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Immunodetection of RAS proteins was carried out with pan-RAS (Ab-3; Calbiochem; 1:1,000) antibodies ...
-
No products found
because this supplier's products are not listed.
Luke M. Rice, Michelle Moritz, David A. Agard,
bioRxiv - Cell Biology 2020
Quote:
... 1 mM GTP in a TLA110 rotor (Beckman, Palo Alto, CA) at 80,000 rpm ...
-
No products found
because this supplier's products are not listed.
Marcus A. Woodworth, et al.,
bioRxiv - Genomics 2020
Quote:
... with Oligo binding buffer (Zymo Research, D4060-1-10). The final product was assumed to have full yield (for a list of sequences ...
-
No products found
because this supplier's products are not listed.
Beatrice Auletta, et al.,
bioRxiv - Cell Biology 2023
Quote:
... insulin-like growth factor 1 (IGF-1, Miltenyi Biotec), FGF-2 and LDN193189 ...
-
No products found
because this supplier's products are not listed.
Stefanie Reuter, et al.,
bioRxiv - Immunology 2021
Quote:
... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
No products found
because this supplier's products are not listed.
Kunlun Li, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Antibody binding was visualized with peroxidase-conjugated sheep anti-rabbit immunoglobulin (Southern Biotech; 4010-05; 1:15000), or sheep anti-mouse immunoglobulin (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Emily M. Mace, et al.,
bioRxiv - Immunology 2019
Quote:
... or control binding antibody (bmab-20, Chromotek). For tight chromatin fractionation ...
-
No products found
because this supplier's products are not listed.
Kazuki Hattori, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with a digital microscope camera (RA-MC120HD, Leica). The medium of the brown adipocytes was replaced with basal culture medium (high-glucose DMEM containing 20% FBS ...
-
No products found
because this supplier's products are not listed.
Lucas Rodrigues-Ribeiro, et al.,
bioRxiv - Physiology 2024
Quote:
... Low-binding microtubes (Eppendorf) were used for processing the samples.
-
No products found
because this supplier's products are not listed.
Yuya Maruyama, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... GTP binding assay was performed using a GTP Gi Binding Assay Kit (Cisbio) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Saeed Roschdi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... GTP was substituted with equal molar concentrations of 7-deaza-GTP (TriLink, N-1044-1) and synthesized in vitro as described in RNA preparation ...
-
No products found
because this supplier's products are not listed.
Matteo Gentili, et al.,
bioRxiv - Immunology 2022
Quote:
... 0.1mM GTP (Cayman Chemicals), 0.2% BSA (Seracare) ...
-
No products found
because this supplier's products are not listed.
Lukasz Chrobok, et al.,
bioRxiv - Neuroscience 2021
Quote:
... glucagon-like peptide 1 (GLP-1; 1µM, Bachem), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX ...
-
No products found
because this supplier's products are not listed.
Yu-Le Wu, et al.,
bioRxiv - Biophysics 2021
Quote:
... Binding of primary antibody (Elys (catalog no. HPA031658, Atlas Antibodies, 1:50), Nup133 (catalog no ...
-
No products found
because this supplier's products are not listed.
Allison Knupp, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The following primary antibodies were used: Ras-related protein Rab-5A (RAB5A) at 1:500 (Synaptic Systems 108 011); early endosome antigen 1 (EEA1 ...
-
No products found
because this supplier's products are not listed.
Meghan Robinson, et al.,
bioRxiv - Bioengineering 2021
Quote:
... anti-Insulin Like 3 (INSL3, Novus Biologicals, NBP1-81223) 1:500 ...
-
No products found
because this supplier's products are not listed.
Annette B. Vogel, et al.,
bioRxiv - Immunology 2020
Quote:
... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...