-
No products found
Nithya Gajendran, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Lentivirus particles expressing human α-syn under cytomegalovirus (CMV) promoter (Applied Biological Materials, Inc, Canada) was used to re-express α-syn in SK-MEL-28 KO cells as described previously30 ...
-
No products found
because this supplier's products are not listed.
Fangzhou Lou, et al.,
bioRxiv - Immunology 2020
Quote:
... Normal Human Epidermal Keratinocytes (NHEKs; Lifeline Cell Technology, cat. FC-0007) stored in liquid nitrogen were defrosted and cultured in serum-free basal medium with growth factors (Lifeline Cell Technology ...
-
No products found
because this supplier's products are not listed.
Caroline Bull, Graham Mayrhofer, Michael Fenech,
bioRxiv - Cancer Biology 2019
Quote:
Human WIL2-NS (B lymphoblastoid) cells (American Type Culture Collection (ATCC); CRL-8155 ...
-
No products found
because this supplier's products are not listed.
Wilton B. Williams, et al.,
bioRxiv - Immunology 2020
Quote:
... while human B cells were CD38+/- (Beckman Coulter #6699531; 1µl per test) and CD19 (BD #557791 ...
-
No products found
because this supplier's products are not listed.
David Andruszewski, et al.,
bioRxiv - Neuroscience 2023
Quote:
... resuspended in PBS/FCS supplemented with Fc-block (BioXCell) and incubated for 15min on ice ...
-
No products found
because this supplier's products are not listed.
Martina Hauke, et al.,
bioRxiv - Microbiology 2023
Quote:
... and 10% FCS (PromoCell, Germany). HEK-NF-κB_luc were supplemented for routine growth with 50 µg/mL Hygromycin B (Invivogen ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... and the gB Domain II was purified with lectin resin (VWR.)
-
No products found
because this supplier's products are not listed.
Salim Benlefki, et al.,
bioRxiv - Neuroscience 2022
Quote:
... enhancer for ligand and recombinant human Fas-Fc were purchased from Enzo Life Sciences. z-IETD-fmk ...
-
No products found
because this supplier's products are not listed.
Wenyang Li, et al.,
bioRxiv - Cell Biology 2023
Quote:
Primary human HSCs were seeded in 384-well plates (CellCarrier-384 Ultra plates, Cat. # 6057300) in stellate cell medium (ScienCell/Innoprot, Cat. # 5301-b) supplemented with 2% FCS (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Haizhang Chen, et al.,
bioRxiv - Immunology 2020
Quote:
... or a PE-TexasRed-conjugated human IgG-Fc fragment (Rockland) for 1h at 4°C in PBS/3%FCS ...
-
No products found
because this supplier's products are not listed.
Brian R. Graziano, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and 1.2 μg cytomegalovirus 8.91 vector were mixed and prepared for transfection using TransIT-293 Transfection Reagent (Mirus Bio) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Harman Malhi, et al.,
bioRxiv - Immunology 2022
Quote:
... Anti-Human Fc biosensors (ForteBio, catalog #18-0015) were submerged in wells of black 96-well microplates (Greiner, catalog #655209) containing 250 μL of kinetics buffer (PBS ...
-
No products found
because this supplier's products are not listed.
Briana Zellner, et al.,
bioRxiv - Microbiology 2021
Quote:
... and polymyxin B (MP Biomedicals). Detergents tested were ...
-
No products found
because this supplier's products are not listed.
Nabil Girollet, et al.,
bioRxiv - Genomics 2019
Quote:
... we obtained a total of 164 Gb of clean data (52 Gb PacBio data ...
-
No products found
because this supplier's products are not listed.
Erik Procko,
bioRxiv - Biochemistry 2020
Quote:
Hydrated anti-human IgG Fc biosensors (Molecular Devices) were dipped in expression medium containing RBD-IgG1 for 60 s ...
-
No products found
because this supplier's products are not listed.
Jing-Ping Lin, et al.,
bioRxiv - Neuroscience 2023
Quote:
... prepared from patient donors) or 200μg recombinant human myelin oligodendrocyte glycoprotein (hMOG 1–125, AS-55158-1000, AnaSpec) emulsified in complete (CFA ...
-
No products found
because this supplier's products are not listed.
Camilla Tiezzi, et al.,
bioRxiv - Immunology 2022
Quote:
... p8.74 packaging vector, pseudotyping vector coding for Spike glycoproteins (Wuhan-Hu-1; B.1 Lineage, China) and pREV with PEI (Polysciences, Inc., Warrington, PA, USA) (1 mg/mL in PBS ...
-
No products found
because this supplier's products are not listed.
BL Spencer, et al.,
bioRxiv - Microbiology 2021
Quote:
... GBS strains were grown in Todd Hewitt Broth (THB; Research Products International, RPI) statically at 37° C ...
-
No products found
because this supplier's products are not listed.
Mariam Taha, et al.,
bioRxiv - Microbiology 2023
Quote:
... b) 500 µL of 10% (v/v) human synovial fluid (BioIVT, Westbury, NY, USA) prepared in sterile Ringer’s solution (37) ...
-
No products found
because this supplier's products are not listed.
Gotravalli V. Rudresha, et al.,
bioRxiv - Pathology 2020
Quote:
... SCH79797 (PAR-1 antagonist) and GB-83 (PAR-2 antagonist) were purchased from Cayman Chemicals (Michigan, USA). U0126 (MEK 1/2 inhibitor) ...
-
No products found
because this supplier's products are not listed.
Julianne B. Riggs, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were subjected to Fc receptor blocking using Fc Shield (Tonbo Biosciences) for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... were coated with 150 ng gB AD-1 domain (MyBiosource), AD-2 domain site 1 (Life Technologies Corporation) ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
MT Heemskerk, et al.,
bioRxiv - Immunology 2021
Quote:
... diluted in PBS for 10 min at RT and Fc-receptors were subsequently blocked using 5% human serum (HS; Sanquin Blood bank, Amsterdam, The Netherlands) for 45 min at RT ...
-
No products found
because this supplier's products are not listed.
Fang Ke, et al.,
bioRxiv - Immunology 2022
Quote:
... NP-specific B cells or SA-specific B cells were detected with BCR specific binding with NP-PE (Biosearch Technologies) or SA-PE (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Solveig G. Schmidt, et al.,
bioRxiv - Biophysics 2023
Quote:
... The uptake reaction was terminated by filtering the samples through a 96 well glass fiber filter (Filtermat B – GF/B, Perkin Elmer) soaked in 1.5% poly(ethyleneimine ...
-
No products found
because this supplier's products are not listed.
Nicole L. Grant, et al.,
bioRxiv - Immunology 2022
Quote:
... and 10% human A/B serum (Gemini Bio-Products, Cat. #100-512). Peptides were added to prepared plates at a final concentration of 1μg/mL-2μg/mL followed by 1x105-2x105 fresh or frozen (rested overnight ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Swarnabh Bhattacharya, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Rho Activator II (Cytoskeleton, CN03-B), or Verteporfin (Sigma ...
-
No products found
because this supplier's products are not listed.
Sonali A. Gandhi, et al.,
bioRxiv - Biophysics 2023
Quote:
FCS was performed with an inverted microscope (IX71, Olympus) that was customized to resolve up to four fluorophores as described previously.26 The optical setup included a super-continuum laser (SC-Pro ...
-
No products found
because this supplier's products are not listed.
Shivneet K. Gill, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Dilutions of human serum (Human Serum age 4-6, Innovative Research) were performed in TBSM ...
-
No products found
because this supplier's products are not listed.
Redouane Aherrahrou, et al.,
bioRxiv - Genetics 2023
Quote:
... Human aortic SMCs (Cell Applications, Inc. ...
-
No products found
because this supplier's products are not listed.
Scott Johnson, et al.,
bioRxiv - Physiology 2023
Quote:
... Recombinant adenovirus encoding N-terminally FLAG-tagged mouse PNPLA3 under the control of a cytomegalovirus (CMV) promoter (Ad-FLAG-PNPLA3) was custom generated by Vector Biolabs. A CMV-null adenovirus (Ad-Null)] was also obtained for use in control experiments ...
-
No products found
because this supplier's products are not listed.
José A. González-Feliciano, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The 2G12 and PG16 bNAbs in 0.5X Kinetics Buffer (PBS with 0.02% Tween and 0.05 mg/mL BSA) were loaded onto an anti-Human IgG Fc Capture sensor (Pall ForteBio Corp). Binding kinetics were determined using serial dilutions of CHO-K1-produced and Expi293F-produced gp145 ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... Fc receptor blocker (Innovex Biosciences), and finally avidin/biotin blocking buffer (Vector Laboratories ...
-
No products found
because this supplier's products are not listed.
Oktawia Nilsson, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and cholesterol (FC) (Avanti Polar Lipids) were dissolved in 3:1 chloroform:methanol ...
-
No products found
because this supplier's products are not listed.
Mukundan Attur, et al.,
bioRxiv - Cell Biology 2019
Quote:
... supplemented with 10% FCS (Atlanta Biologicals). Cells at 50-70% confluency were transfected by overnight incubation with the indicated cDNAs in complete growth medium using TransIT®-LT1 - Transfection Reagent according to the manufacturer’s instructions (Mirus Bio ...
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Danila Boytsov, et al.,
bioRxiv - Biophysics 2022
Quote:
... the FCS unit (Confocor3, Carl Zeiss, Jena, Germany) of a commercial laser scanning microscope (LSM 510 ...
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Emily A Wheeler, et al.,
bioRxiv - Immunology 2023
Quote:
... and Factor B were purchased from Complement Technologies.
-
No products found
because this supplier's products are not listed.
Adam K. Wade-Vallance, et al.,
bioRxiv - Immunology 2022
Quote:
... αIgE with a mutated Fc-receptor binding domain (clone R1E4; Cedarlane), or control rat gamma globulin were diluted in D-PBS to a concentration of 0.3mg/mL and injected intravenously to achieve a final dose of 3.25mg/kg ...
-
No products found
because this supplier's products are not listed.
Yongjin Sung, et al.,
bioRxiv - Biophysics 2019
Quote:
... we used a fluorescence filter set (Nikon, B-2E) with an excitation band of 450 – 490 nm ...
-
No products found
because this supplier's products are not listed.
Xiaoxuan Zhuang, et al.,
bioRxiv - Immunology 2023
Quote:
... containing 10% human serum (Valley Biomedical) and were used within 4 days ...
-
No products found
because this supplier's products are not listed.
Kira Allmeroth, et al.,
bioRxiv - Physiology 2022
Quote:
... Mice expressing the cre recombinase under the control of the human cytomegalovirus minimal promoter (CMV-cre+/-) were purchased from Charles River Laboratories (Sulzfeld ...
-
No products found
because this supplier's products are not listed.
Maurice Michel, et al.,
bioRxiv - Biochemistry 2024
Quote:
... goat anti-human IgG-Fc Alexa488 (Dianova, 1:400) or goat antihuman IgM Alexa 594 (Molecular Probes ...
-
No products found
because this supplier's products are not listed.
Marcel Lagedroste, et al.,
bioRxiv - Biochemistry 2019
Quote:
Fos-choline 16 (FC-16) and CYMAL5 (C5) were obtained from Anatrace. Lyophilized nisin powder (2.5% nisin content ...
-
No products found
because this supplier's products are not listed.
Zbigniew Korwek, et al.,
bioRxiv - Immunology 2023
Quote:
... Human interferon β (PBL Assay Science) was used at a typical concentration of 1000 U/ml and ...