-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Patricia K. Dranchak, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The library was arrayed as DMSO stock solutions in Echo-qualified 384-well cyclic olefin copolymer plates (Labcyte, Inc.) formatted for qHTS ...
-
No products found
because this supplier's products are not listed.
Ann Marie Centner, et al.,
bioRxiv - Cell Biology 2024
Quote:
... A commercial Cotinine ELISA kit (Origene) suitable for mice was used to quantify blood levels ...
-
Cyclic Diguanylate (c-di-GMP) ELISA Kit is an ELISA Kit for the in vitro quantitative...
Cat# abx511994-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Michał Kiełbus, et al.,
bioRxiv - Bioengineering 2019
Quote:
... they were genotyped by PCR using Mouse Direct PCR Kit (Bimake), following the manufacturers instruction ...
-
No products found
because this supplier's products are not listed.
Hao Yan, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits were used to measure estrogen (Calbiotech ES180S-100), progesterone (IBL America ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...
-
No products found
because this supplier's products are not listed.
Anqi Yu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... RNA samples were prepared following the Direct-zol RNA Miniprep kit manual (RPI, ZR2052). Reverse transcription was performed using Applied Biosystems High-Capacity cDNA Reverse Transcription Kit (43-688-14 ...
-
No products found
because this supplier's products are not listed.
Saritha S. D’Souza, et al.,
bioRxiv - Cell Biology 2021
Quote:
... A p27 ELISA (Zeptometrix) was performed on each time point according to the manufacturer’s instructions to determine the amount of virus produced in each well.
-
No products found
because this supplier's products are not listed.
Qi Ding, et al.,
bioRxiv - Neuroscience 2019
Quote:
... PI3 kinase activity was measured using PI3 kinase activity ELISA kit from Echelon Biosciences according to the manufacture’s protocol ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
Celase® GMP is a proprietary, proteolytic enzyme blend produced, packaged and labeled by Cytori...
Cat# 1235-01,
1 vi, $1000.00
Ask
Manci Li, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Organoid tissue retained on the filter was then back-flushed with 25 ml of cold HBSS and this tissue was further disaggregated in 2 ml Collagenase II (Celase GMP, Worthington Biochemical Corporation, Lakewood, NJ) also containing 200 μg DNAse1 ...
-
No products found
because this supplier's products are not listed.
Eric J. Martin, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Images were assembled in Adobe Illustrator following direct export from Nikon Elements software ...
-
No products found
because this supplier's products are not listed.
Martijn Selten, et al.,
bioRxiv - Neuroscience 2023
Quote:
AAV8 viruses were produced in HEK293FT cells grown on 5 plates (linear PEI, Polysciences Europe Cat. No. 23966-100) or 10 plates (branched PEI ...
-
No products found
because this supplier's products are not listed.
Julian R. Smith, et al.,
bioRxiv - Immunology 2022
Quote:
H1 control AC16 cardiomyocytes and cGAS KO AC16s were seeded in 12-well plates and transfected with 5 mg of CT-DNA using Transit X2 (Mirus) at a 2:1 ratio for 8 h prior to harvest ...
-
No products found
because this supplier's products are not listed.
Laura Mòdol, Monika Moissidis, Oscar Marín,
bioRxiv - Neuroscience 2023
Quote:
... a custom-made head plate containing a 5 mm diameter hole was fixed to the skull using veterinary adhesive (Vetbond, 3M). Once the head plate was fixed and stabilized ...
-
No products found
because this supplier's products are not listed.
Kejia Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Immunoblots were scanned using direct infrared fluorescence via the Odyssey system (LI-COR Biosciences).
-
No products found
because this supplier's products are not listed.
Randy Yoo, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 96-well plate low volume crystallization plates (Hampton Research) were all set up at room temperature using sitting drop method with ratios 1:1 and 1:2 for precipitant to protein ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Andrea Rizzotto, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and 5 μL of 5 μg/mL Propidium Iodide (Biotium) for cell death detection ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
No products found
because this supplier's products are not listed.
Lotta Pohjolainen, Heikki Ruskoaho, Virpi Talman,
bioRxiv - Cell Biology 2022
Quote:
The hiPSC-CMs were exposed to cyclic mechanical stretch by applying vacuum suction to the BioFlex® plates with an FX-5000 Tension System (Flexcell International Corporation). For pharmacological assays ...
-
No products found
because this supplier's products are not listed.
Yifeng Wang, et al.,
bioRxiv - Immunology 2023
Quote:
... 96-well ELISA plates (42592, Costar) were coated with NP23-BSA (Biosearch Technologies) in PBS overnight and washed ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Nikolaus Frischauf, et al.,
bioRxiv - Immunology 2024
Quote:
... In a regular 96 ELISA flat bottom plate 15% normal human serum (Sanquin, Amsterdam, The Netherlands) was added to the liposome mixture (R1 from the kit ...
-
No products found
because this supplier's products are not listed.
Hailong Guo, et al.,
bioRxiv - Microbiology 2023
Quote:
384 well ELISA plates were coated with 20µl of RBD (SARS-CoV-2 Omicron BA.1, ACROBiosystems) at 1µg/mL in PBS at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Vignesh Narayan Hariharan, et al.,
bioRxiv - Microbiology 2019
Quote:
... Equilibrated mixtures containing 5µM of PdtaS-EGFP and varying concentrations of c-di-GMP were loading onto hydrophobic capillaries (NanoTemper Technologies). The laser on and off times were set at 30s and 5s respectively ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Alexander P. Clark, et al.,
bioRxiv - Bioengineering 2021
Quote:
Human embryonic kidney cells 293 stably expressing human hyperpolarization-gated cyclic nucleotide-sensitive cation channel 1 (HEK-HCN1) were obtained from Charles River (CT6114). Cells were cultured and maintained according to the online protocol by Charles River ...
-
No products found
because this supplier's products are not listed.
Sebastian J. Ross, et al.,
bioRxiv - Synthetic Biology 2024
Quote:
... either Midori green direct dye (Geneflow) or ethidium bromide (Alfa Aesar) staining was applied ...
-
No products found
because this supplier's products are not listed.
Chao Ye, et al.,
bioRxiv - Systems Biology 2023
Quote:
... Genomic DNA extraction was done by either boiling cells in 25 μL of 20 mM NaOH at 95 °C for 15 min or by using the Direct DNA Extraction Kit (Bacteria) (Norgen Biotek, Thorold, ON, Canada) following the manufacturer’s manual.
-
No products found
because this supplier's products are not listed.
Pragati Chengappa, et al.,
bioRxiv - Cell Biology 2021
Quote:
Direct measurements of intracellular pressure were performed using the 900A micropressure system (WPI) according to the manufacturer’s instructions and as described (34) ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Agnieszka Szmitkowska, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and grown on vertically oriented plates for five more days prior to imaging with the Axiolab 5 (Carl Zeiss Microscopy, GmbH). To determine the AHK5-dependent ethylene effect on the root cap ...
-
Cat# HY-107780-1 mg,
1 mg, inquire
Ask
Konsta Karttunen, et al.,
bioRxiv - Genomics 2022
Quote:
... GP5d cells were seeded in 6 well plates and treated with 500 nM/L 5-aza-2’-deoxycytidine (MedChemExpress, HY-A0004) or DMSO (Fisher ...
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Huan Peng, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5-bromosalicylic acid (5-BAA) (>98.0%; TCI), isopropyl β-D-1- thiogalactopyranoside (IPTG ...
-
No products found
because this supplier's products are not listed.
Daniel Wells, et al.,
bioRxiv - Genetics 2019
Quote:
... and the resulting immune antisera were tested against the recombinant antigen by ELISA (Eurogentec), and the endogenous protein in mouse testes from WT and KO mice (data not shown) ...
-
No products found
because this supplier's products are not listed.
Fabian S. F. Hartmann, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... The working plate (96-well plate) was used as a source plate for robotic spotting using a ROTOR HDA benchtop robot (Singer Instruments, United Kingdom) on rectangular OmniTray plates (Singer Instruments ...
-
No products found
because this supplier's products are not listed.
Adnan K. Syed, et al.,
bioRxiv - Microbiology 2020
Quote:
... Once the biofilms were grown for 24 hours they were washed three times with 200 μl of PBS at pH 7.5 and then resuspended in 200 μl of PBS at pH 7.5 and transferred to a filter plate (0.2-μm AcroPrep Advance 96-well filter plates no. 8019; Pall). 100 μl of the filtrate was then combined with 100 μl of 2 μM SYTOX Green (no ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)