-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
No products found
because this supplier's products are not listed.
Min-Young Noh, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and CSF NfLs were measured with an ELISA kit (UmanDiagnostics AB, Umeå, Sweden). HC samples were collected from ALS patient spouses after obtaining consent.
-
No products found
because this supplier's products are not listed.
MN Gnanapragasam, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... but upstream (in frame) of the Fok1 nuclease and bGH poly(A) signals (PNA Bio Inc). In addition ...
-
No products found
because this supplier's products are not listed.
Caijun Wu, et al.,
bioRxiv - Immunology 2022
Quote:
... Mouse Factor X total antigen was measured using kit from Molecular Innovations (Cat. No. MFXKT-TOT).
-
No products found
because this supplier's products are not listed.
Suzann Duan, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Media was supplemented with their respective growth factor kits and 10% EV-depleted FBS (Atlanta Biologicals, Flowery Branch, GA). MDA-MB-231 ...
-
No products found
because this supplier's products are not listed.
Nadja I. Lorenz, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml human recombinant basic fibroblast growth factor (bFGF) (ReliaTech, Wolfenbüttel, Germany).
-
No products found
because this supplier's products are not listed.
Justin R. Blanch, et al.,
bioRxiv - Genetics 2022
Quote:
... and sequenced with a primer located upstream of the I-SceI cut site (DR-white2, 5’ ATGCAGGCCAGGTGCGCCTATG 3’) (Eton Bioscience).
-
No products found
because this supplier's products are not listed.
Karl E Carlström, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The Casp8 ELISA (EKR1606) (Nordic Biosite, Sweden), Bid ELISA (NBP2-69968 ...
-
No products found
because this supplier's products are not listed.
Lydia Maus, et al.,
bioRxiv - Neuroscience 2019
Quote:
Single-axis tilt series were acquired on a JEOL JEM-2100 200kV transmission electron microscope from −60° to + 60° in 1° increments and binned by a factor of two at 30,000 times magnifications with an Orius SC1000 camera (Gatan) using SerialEM for acquiring automated tilt series (Mastronarde ...
-
No products found
because this supplier's products are not listed.
Seth J. Zost, et al.,
bioRxiv - Immunology 2021
Quote:
... The plates were washed and 25 μL of ELISA buffer containing a 1:4,000 dilution of anti-human IgG alkaline phosphatase conjugate (Meridian Life Science, W99008A) was added ...
-
No products found
because this supplier's products are not listed.
Christophe Chapard, et al.,
bioRxiv - Genetics 2023
Quote:
... Yeast cells were synchronized in G1 by adding α-factor (Proteogenix, WY-13) in the media every 30 min during 2h30 (1 μg/mL final) ...
-
No products found
because this supplier's products are not listed.
Whasil Lee, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... then next the Transcription factor (TF) Activation Profiling Plate Array II (FA-1002, Signosis, CA) was used to monitor 96 TFs simultaneously ...
-
No products found
because this supplier's products are not listed.
Mouhamed Alsaqati, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and ESGRO leukemia inhibitory factor (LIF) (Chemicon) at 37°C in an incubator (Galaxy 170R, New Brunswick, USA). The mECs media were changed daily and cells were passaged every other day using TrypLE (Gibco ...
-
No products found
because this supplier's products are not listed.
Cellas A. Hayes, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cells were grown on a T-75 flasks pre-coated with Cell Attachment Factor Solution (123-100, Cell Applications), in 15mL of RBMVEC growth medium (R819-500) ...
-
No products found
because this supplier's products are not listed.
Jens O. Watzlawik, et al.,
bioRxiv - Neuroscience 2024
Quote:
... the supernatant of each single B cell well was screened for antigen specificity through direct ELISA for targeting full-length monomeric p-S65-Ub protein (Boston Biochem, U-102), free p-S65-Ub peptides 1 and 2 and BSA-conjugated p-S65-Ub peptides 1 and 2 (provided by 21st Century Biochemicals) ...
-
No products found
because this supplier's products are not listed.
K.K Vishnolia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... RNA (1 µg) was transcribed using the Precision mqScript Reverse Transcription Kit (Primerdesign Ltd, UK) according to the manufacturer’s protocol and the cDNA was diluted 1:2 in molecular biology grade water (Sigma,UK) ...
-
No products found
because this supplier's products are not listed.
Fabio Tommasini, et al.,
bioRxiv - Bioengineering 2023
Quote:
Tissue slides were stained using the Movat Pentachrome Stain kit (Cat. # MPS-1, Scytek, USA). Briefly ...
-
No products found
because this supplier's products are not listed.
Charneal L. Dixon, et al.,
bioRxiv - Immunology 2023
Quote:
... cDNA was synthesized from 1 µg RNA using SensiFAST cDNA Synthesis Kit (FroggaBio; Concord, Canada). qPCR was performed using a QuantStudio™ 7 Flex Real-Time PCR System in conjunction with a SybrGreen System (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
David N. Fiflis, et al.,
bioRxiv - Bioengineering 2024
Quote:
PCR reactions cleaned up by electrophoresis on a 1% agarose gel and extracted using a Gel Extraction and PCR cleanup Kit (IBI Scientific). Purified DNA was the submitted for sanger sequencing (Genewiz) ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Vit Kit (Irvine Scientific) was used for vitrified embryos ...
-
No products found
because this supplier's products are not listed.
Morgan Panitchpakdi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... UHPLC C18 for 2.1 mm internal diameter columns), and Phree™ Phospholipid Removal Kit (30 mg/well, 96-well plate) were purchased from Phenomenex (Torrance, CA, USA). Eppendorf® Microplate 96/U-PP (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Mark A. Arick II, et al.,
bioRxiv - Genomics 2022
Quote:
A Hi-C library also was prepared using 100 μL of Rohu-1 blood with the Proximo Hi-C Animal Kit (Phase Genomics, Seattle, WA, USA). The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Kenneth H. Hu, et al.,
bioRxiv - Genomics 2020
Quote:
The Thunder-Link Plus kit (Expedeon) was used to conjugate the amine modified anchor strand to an anti-mCD45 antibody (clone 30F-110 ...
-
No products found
because this supplier's products are not listed.
Breah LaSarre, et al.,
bioRxiv - Microbiology 2020
Quote:
... or Bactozol kit (Molecular Research Center). Because E ...
-
No products found
because this supplier's products are not listed.
Jeremy F Brooks, et al.,
bioRxiv - Immunology 2020
Quote:
Immunogens were admixed 1:1 with Alhydrogel 1% adjuvant (Accurate Chemical and Scientific Corp.) and injected i.p ...
-
No products found
because this supplier's products are not listed.
Esther Riemer, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Seedlings were labeled by adding 30 μCi mL−1 of [3H]-myo-inositol (30 to 80 Ci mmol−1 and 1 mCi mL−1; American Radiolabeled Chemicals) and further cultivated for 5 days ...
-
No products found
because this supplier's products are not listed.
André L. Samson, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-RIPK3 (ProSci #2283; 1:1000/1:200), rabbit anti-human RIPK3 (Novus Biological NBP2-24588 ...
-
No products found
because this supplier's products are not listed.
Li Sun, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 1 μM 1-NM-PP1 (Toronto Research Chemicals; A603003) was added into one of the cultures to inactivate Cdc2 (Cdk1 ...
-
No products found
because this supplier's products are not listed.
Anna Velica, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A stock solution was made from 1 mg of CLZ (Hello Bio, batch E0697-1-1) (CLZ ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Till M. Muenker, Bart E. Vos, Timo Betz,
bioRxiv - Biophysics 2024
Quote:
... and a fresh 1:10,000 dilution of 1 µm beads (Polybead® Microspheres 1 µm, Polyscience, Inc) in medium was added to the sample ...
-
No products found
because this supplier's products are not listed.
Nahima Saliba, et al.,
bioRxiv - Biophysics 2023
Quote:
... Tubing (FEP 1/16” OD, 1/100” ID, Cole-Parmer) was connected from the pump to the microfluidic chip for solution perfusion.
-
No products found
because this supplier's products are not listed.
Rémi Ronzano, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-mCherry (1:1000 to 1:2000, EnCor Biotechnology), mouse IgG2a anti-GAD67 (clone 1G10.2 ...
-
No products found
because this supplier's products are not listed.
Irene Riera-Tur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 1% Hepes (Biomol). Only low passage cells were used ...
-
No products found
because this supplier's products are not listed.
Katy Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and mCherry (ThermoFisher #PA534974 at 1:1000; Invitrogen #M11217 at 1:500; PhosphoSolutions #1203-mCherry at 1:10,000). Multiple PDE11A antibodies were utilized to discern the ectopic accumulation of PDE11A4 in ghost axons ...
-
No products found
because this supplier's products are not listed.
Bill Ling, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 44 µL of a 1:1 mixture of BTTAA (Click Chemistry Tools, 77.4 mg mL-1 PBS) and copper sulfate pentahydrate (7.4 mg mL-1 water) ...
-
No products found
because this supplier's products are not listed.
Debabrata Chowdhury, et al.,
bioRxiv - Immunology 2021
Quote:
First Strand cDNA Synthesis Flex Kit (Thomas Scientific). Taqman primer/probe sets (Applied Biosystems ...
-
The Bimake Cell Counting Kit-8 (CCK-8) is a fluorescent assay for the determination of cell...
Cat# B34304, SKU# B34304-25 mL (2500 rxns),
25 mL (2500 rxns), $201.00
Ask
Musleh M. Muthana, et al.,
bioRxiv - Immunology 2023
Quote:
... Cell Counting Kit-8 (CCK-8) (Bimake, B34304). 1-Step™ Ultra TMB-ELISA Substrate Solution (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... AP1153a, Abcepta, 1:500), rabbit anti-CHIKV antiserum (IBT Bioservices, 1:10,000) or mouse anti-p24 (ExBio, 1:1000). Secondary antibodies conjugated to Alexa680/800 fluorescent dyes were used for detection and quantification by Odyssey Infrared Imaging System (LI-COR Biosciences).
-
K+ channel opener
Sold for research purposes only.
Cat# 1313.0, SKU# 1313-50 mg,
50mg, US $165.00 / EA, EURO, €150 / EA
Ask
Anne Bruun Rovsing, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... BTB-1 (Axon Medchem) was dissolved in DMSO and diluted in saline.
-
No products found
because this supplier's products are not listed.
Aurélien Courtois, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500) and ACA (human, 15-234, Antibodies Incorporated, 1:200 (Figure 5) or 1:500 (other figures) ...
-
No products found
because this supplier's products are not listed.
Hartwig Seitter, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1 µM TTX (Biotrend, BN0518), pH = 7.4 with NaOH (S2770) ...
-
No products found
because this supplier's products are not listed.
Daniel Mott, et al.,
bioRxiv - Immunology 2023
Quote:
BioMag®Plus Amine protein coupling kit (Bangs Laboratories Inc.) (Catalog #86000-1 ...
-
No products found
because this supplier's products are not listed.
Maureen C. Lamb, et al.,
bioRxiv - Cell Biology 2019
Quote:
... the following primary antibody was used: rabbit anti-GFP 1:2000 (pre-absorbed on yw ovaries at 1:20 and used at 1:100; Torrey Pines Biolabs, Inc., Secaucus, NJ) and rabbit anti-dsRed 1:300 (Clontech ...
-
No products found
because this supplier's products are not listed.
Wenhao Xu, et al.,
bioRxiv - Microbiology 2023
Quote:
... 1-μl capillaries (Microcaps, Drummond Scientific) were heat-sealed at one end and filled with buffer (control ...
-
No products found
because this supplier's products are not listed.
Shanghang Shen, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The animals were moved into a warm (37.0 ± 1 °C) recovery chamber (Product #DW-1, Harvard Apparatus, USA) to prevent postischemic hypothermia ...
-
No products found
because this supplier's products are not listed.
Adam S Hassan, et al.,
bioRxiv - Immunology 2019
Quote:
... 1 mM L-glutamine (all from Wisent Bioproducts), 0.05 mM 2-mercaptoethanol (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Maayan Karlinski Zur, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... and 1 mm (BF200-100-10, SUTTER INSTRUMENTS) for 70 days old coricOs.