-
No products found
because this supplier's products are not listed.
Lu Lu, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Quantitative detection of IgM/IgG in exosomes was performed according to the manufacturer’s instructions (IgM/IgG cow ELISA kit, Abcam, UK). The absorbance was determined on a plate reader using the contents of each well at 450 nm ...
-
No products found
because this supplier's products are not listed.
Huahao Fan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Goat and cow whey protein were purchased from Sigma (USA). The recombined lactoferrin (rLF) ...
-
No products found
because this supplier's products are not listed.
Damián Hernández, et al.,
bioRxiv - Neuroscience 2020
Quote:
Levels of total APOE protein were analysed by Human ELISA Kit from Invitrogen (Apolipoprotein E Human ELISA Kit). Levels of Aβ were analysed by ELISA (Human β Amyloid 42 ELISA Kit Wako high sensitive #298-64401 and Human β Amyloid 40 ELISA Kit Wako #298-64601 ...
-
No products found
because this supplier's products are not listed.
Mafalda Cacciottolo, et al.,
bioRxiv - Immunology 2023
Quote:
... Nucleocapsid level on exosomes was measured by ELISA using precoated ELISA plates (Legend Max SARS-CoV2 Nucleocapsid protein ELISA Kit, 448007, BioLegend) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Guoli Shi, et al.,
bioRxiv - Microbiology 2022
Quote:
... IL-6 protein was detected by Hamster IL-6 Sandwich ELISA Kit (AssayGenie) or Mouse IL-6 Duoset Sandwich ELISA kit (R&D Systems) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Erin L. Sternburg, et al.,
bioRxiv - Molecular Biology 2022
Quote:
ColIV protein quantification by ELISA was conducted using a COL4 ELISA kit (MBS2701454, MyBioSource) per manufacturer’s specifications ...
-
No products found
because this supplier's products are not listed.
Hiroyasu Aoki, et al.,
bioRxiv - Immunology 2023
Quote:
... and RayBio COVID-19 N protein Human IgG ELISA Kit (RayBiotech) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Scott M. Gordon, et al.,
bioRxiv - Immunology 2020
Quote:
... OptEIA ELISA kits (BD) for mouse were used ...
-
No products found
because this supplier's products are not listed.
Tshegofatso Ngwaga, et al.,
bioRxiv - Microbiology 2023
Quote:
Protein carbonyls were quantified using the OxiSelect Protein Carbonyl ELISA Kit (Cell Biolabs) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... Levels of TSH and GH were determined by enzyme-linked immunoassay (ELISA) using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; GH ELISA kit, Crystal Chem, Cat No. 80587) respectively according to manuals ...
-
No products found
because this supplier's products are not listed.
Bakhos Jneid, et al.,
bioRxiv - Immunology 2021
Quote:
2’3’-cGAMP ELISA Kit (Cayman Chemical) was used for the quantification of cGAMP in cGAMP-VLP according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Xilin Wu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the protein was coated to high protein-binding ELISA plates (Corning) at a concentration of 0.5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Zeenat A. Shyr, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and proinsulin ELISA kit (Mercodia, Uppsala, Sweden) respectively from batches of ten size-matched islets after acid-ethanol extraction [12].
-
No products found
because this supplier's products are not listed.
Aditya Kumar, et al.,
bioRxiv - Bioengineering 2022
Quote:
... ELISA was performed using the ELISA Starter Accessory Kit (Bethyl, E101) per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sasha Reschechtko, et al.,
bioRxiv - Physiology 2022
Quote:
... The ELISA kits (ALPCO, Salem, NH, USA) we used to measure plasma progesterone concentrations have a sensitivity of 0.32 nmol/L and a range up to 191 nmol/L.
-
No products found
because this supplier's products are not listed.
Sabira Mohammed, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... mouse HMGB1(high mobility group protein B1) ELISA Kit from Elabscience (Houston, TX). The optical density readings obtained were used to generate a four-parameter logistic curve and the concentration of the analytes in the samples were calculated by comparing to the standard curve generated.
-
No products found
because this supplier's products are not listed.
Feng Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... TNF-α protein level was measured by using an ELISA kit from PeproTech (#900-K25) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Pazhanichamy Kalailingam, et al.,
bioRxiv - Pathology 2024
Quote:
... Pcmt1 shRNA in PLKO plasmid (GCGCTAGAACTTCTATTTGAT, TRCN0000036400, Sigma-Merck USA) was transfected into HUVECs ...
-
No products found
because this supplier's products are not listed.
Kazuhiro Hayashi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ELISA kits (Mouse BDNF ELISA Kit PicoKine™ EK0309)(Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Emma S. Noel, et al.,
bioRxiv - Neuroscience 2024
Quote:
... A corticosterone ELISA kit (Enzo Life Sciences) was used to quantify corticosterone levels in blood serum samples ...
-
No products found
because this supplier's products are not listed.
Marek Petráš, et al.,
bioRxiv - Microbiology 2020
Quote:
The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
No products found
because this supplier's products are not listed.
Claudia Ollauri-Ibáñez, et al.,
bioRxiv - Physiology 2019
Quote:
... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Acharya Balkrishna, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... CB-Protein Assay kit and MCP-1 ELISA kit from G-Biosciences, India ...
-
No products found
because this supplier's products are not listed.
Kevin R. Bewley, et al.,
bioRxiv - Pathology 2020
Quote:
... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ...
-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Yibo Yin, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Biotinylated protein L (GenScript) and the addition of streptavidin-coupled PE (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Abulaish Ansari, et al.,
bioRxiv - Physiology 2023
Quote:
... and apoB (Mabtech ELISA Kits) in triplicate ...
-
No products found
because this supplier's products are not listed.
Nikhil J. Parekh, et al.,
bioRxiv - Immunology 2019
Quote:
IFN-β protein was detected using the mouse Hi-Sensitivity IFN-β ELISA kit (PBL Assay Science). CCL4 protein was detected using the mouse CCL4/MIP-1 beta Quantikine ELISA kit (R&D Systems) ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Shelly J. Robertson, et al.,
bioRxiv - Microbiology 2023
Quote:
... SARS-CoV-2 spike protein-specific IgG was measured using SARS-CoV2 spike protein serological IgG ELISA kit (Cell Signaling Technology) per manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
No products found
because this supplier's products are not listed.
Mithu Baidya, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 20 μl of pre-equilibrated Protein L (Capto L, GE Healthcare) beads (20mM HEPES ...
-
No products found
because this supplier's products are not listed.
Lanlan Zhou, et al.,
bioRxiv - Cell Biology 2020
Quote:
Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
No products found
because this supplier's products are not listed.
Richard de Reuver, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse CXLC10 protein was quantified using ELISA (eBioscience; BMS6018MST) and Bio-Plex (Bio-Rad; #12002244). Human recombinant IFN-α2 was from Biolegend (592704 ...
-
No products found
because this supplier's products are not listed.
Ruidong Xiang, et al.,
bioRxiv - Genomics 2022
Quote:
... and cows were genotyped with the BovineSNP50 Beadchip (Illumina Inc). The genotype data for CattleGTEx animals were generated previously 4 and included a total of more than 6 million sequence variants imputed also using Run7 of the 1000 Bull Genomes Project ...
-
No products found
because this supplier's products are not listed.
E. Attree, et al.,
bioRxiv - Genetics 2023
Quote:
DNA was extracted from whole blood samples from six calves (three healthy and three diseased) and four adult cows using the DNEasy Kit (Qiagen) according to the manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Lucy A. Barry, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Primary antibodies used were rabbit anti-cow glial fibrillary acidic protein (GFAP; 1:5000; Z0334; Dako, Carpinteria, CA, USA) to detect astrocytes ...
-
C-Reactive Protein ( CRP ) ELISA / Assay Kit
Cat# K069-H5,
1.0 ea, USD $1520.0
Ask
Anthony G. Pacholko, Lane K. Bekar,
bioRxiv - Neuroscience 2019
Quote:
Fecal pellets were collected from the colon during sacrifice and immediately stored on dry ice for subsequent ethanol extraction (100 μL ethanol/10 mg fecal powder) and equal volume measurement of corticosterone metabolites using an ELISA-based Assay Kit (Arbor Assays). Fecal samples were chosen over serum as they better represent a long-term average less influenced by rapid stress-induced changes in corticosterone expression ...
-
No products found
because this supplier's products are not listed.
Bhagawati Jalnapurkar, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Neurofilament light chain (NF-L) was quantified using Mouse NF-L ELISA Kit (Novus Biologicals, Catalog #NBP2-80299) and read on a SpectraMax iD5 (Molecular Devices ...
-
No products found
because this supplier's products are not listed.
José Ursic-Bedoya, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and protein quantification was assayed using human FGF19 ELISA kit (Biovendor, RD191107200R). Protein was then diluted 1:2 in PBS+0.2%BSA and stored at - 20°C.
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... were assayed using ELISA using the Monkey IL12 ELISA Kit (LifeSpan BioSciences, Inc.), Monkey IFN alpha (pan ...
-
No products found
because this supplier's products are not listed.
James A Davey, Natalie K Goto,
bioRxiv - Synthetic Biology 2023
Quote:
... Vector DNA was dephosphorylated using quick cow intestinal phosphatase (QCIP) and ligation reactions conducted using T7 DNA ligase (NEB). Purification of DNA products was done by PCR cleanup (E.Z.N.A Cycle Pure Kit ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Qinrui Wang, et al.,
bioRxiv - Biophysics 2019
Quote:
... 1 L of Sf9 insect cells in Insect-XPRESS Protein-free Insect Cell Medium with L-glutamine (Lonza) in a 3 L flask was infected with 5 ml of the harvested P2 (second passage ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Vedita Anand Singh, et al.,
bioRxiv - Molecular Biology 2023
Quote:
High protein binding 96-well ELISA plate (Greiner bio-one, USA) was coated with 1 µg/well of RBD protein (home-made ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The Miro1 protein level in each sample collected was determined using the RHOT1 ELISA Kit 96T (EKL54911, Biomatik) according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Clément Blot, et al.,
bioRxiv - Microbiology 2023
Quote:
... Nrf2 TransAM ELISA-kit (Active Motif) was used to evaluate Nrf2 DNA-binding activity ...