-
No products found
because this supplier's products are not listed.
Laura Lorenzo-Orts, et al.,
bioRxiv - Biochemistry 2019
Quote:
... biotinylated medium chain polyP (5-20 ug/uL, Kerafast) or 5’-biotinylated single-strand DNA (5 ug/uL ...
-
No products found
because this supplier's products are not listed.
Arwa Fallatah, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Samples were blocked in 5% normal goat serum (NGS; RMBIO, Missoula, MT) in 1X PBS before staining with primary antibodies diluted at 1:400 ratio in 5% NGS blocking buffer and a mixture of 1:1000 of Alexa Fluor 488-conjugated goat anti-mouse secondary antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Nwamaka J. Idigo, et al.,
bioRxiv - Genetics 2019
Quote:
... NADH and 16S (selected using the geNorm kit from PrimerDesign Ltd UK). Prevalidated primers (PrimerDesign Ltd UK ...
-
No products found
because this supplier's products are not listed.
M-W. Peng, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The V3-V4 regions of the anammox 16S rRNA gene were amplified with the primer 338F (5’-ACTCCTACGGGAGGCAGCAG-3’) and the primer 806R (5’-GGACTACHVGGGTWTCTAAT-3’) using polymerase chain reaction (PCR) (ABI GeneAmp 9700). The PCR program was as follows ...
-
No products found
because this supplier's products are not listed.
JM Robinson, et al.,
bioRxiv - Immunology 2019
Quote:
... I-FABP (Human I-FABP ELISA Kit, Hycult biotech, Cat# HK406), and LBP (Human Lipopolysaccharide Binding Protein ELISA Kit ...
-
No products found
because this supplier's products are not listed.
Joanne Kite, et al.,
bioRxiv - Microbiology 2021
Quote:
... Quantitative polymerase chain reaction (qPCR) was performed with the MESA BLUE qPCR kit for SYBR assay (Eurogentec) on a LightCycler96 system (Roche ...
-
No products found
because this supplier's products are not listed.
Li Liu, Dongmei Wang, Ping Li, Huan Zhao,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Quantitative real-time polymerase chain reaction (qRT-PCR) was performed SuperReal PreMix Plus kit (Tiangen Biotech, China) by ABI 7500 Q-PCR system (Applied Biosystems ...
-
No products found
because this supplier's products are not listed.
S Ramachandran, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Light-chain BoNT/B (Calbiochem; 50 μg ml−1), was stored at −20°C in 20 mM sodium phosphate ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...
-
No products found
because this supplier's products are not listed.
Alexandra Cheslock, et al.,
bioRxiv - Physiology 2020
Quote:
... 0.22 mM NADH (Bio Basic, NBO642), 50 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Rostislav Bychkov, et al.,
bioRxiv - Physiology 2020
Quote:
... The microscope was mounted on a motorized X-Y MT-2078/MT-2278 translator (Sutter Instruments). The experimental chamber with the SAN preparation was placed on a platform (Sutter Instruments ...
-
No products found
because this supplier's products are not listed.
Nicole Eliason, et al.,
bioRxiv - Neuroscience 2022
Quote:
MT-II (Phoenix Pharmaceuticals, Burlingame, CA) was reconstituted in sterile saline in a stock solution at a concentration of 10 nmol/ul and stored at -20 C ...
-
No products found
because this supplier's products are not listed.
Jia-Pu Liang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Dex ELISA kit (Cat. No. 101516; Neogen) and E2 High sensitivity ELISA kit (Cat ...
-
Cow NADH-ubiquinone oxidoreductase chain 5 (MT-ND5) ELISA Kit is an ELISA Kit for the in vitro...
Cat# abx555808-96T,
96 tests USD $797.5
Ask
Robert Schierwagen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
We determined plasma levels of beta-arrestin-2 using an ELISA kit (Human Beta-arrestin-2 ELISA Kit; # abx251362; Abbexa) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kouhei Yoshida, et al.,
bioRxiv - Bioengineering 2023
Quote:
The AAV Titration ELISA Kit series (PROGEN Biotechnik GmbH) was used to quantify AAV capsid titers depending on the AAV serotype ...
-
No products found
because this supplier's products are not listed.
Charlene J. Miller, et al.,
bioRxiv - Microbiology 2023
Quote:
... an ELISA kit from Life Diagnostics (West Chester, PA). Assays were completed according to the manufacturer’s recommended protocols and all samples were assessed in duplicate ...
-
No products found
because this supplier's products are not listed.
Ruth Pye, et al.,
bioRxiv - Immunology 2020
Quote:
... and placed in clot activating tubes (MTS, Sarstedt) for subsequent serum separation ...
-
No products found
because this supplier's products are not listed.
Abigail M. Schwarz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and istradefylline (Tokyo Chemical Industry, Lot #2PJUO-MT) were dissolved in ratios of 10:10:80 and 20:10:70 in DMSO:Tween80:USP saline ...
-
No products found
because this supplier's products are not listed.
Nina R. Montoya, et al.,
bioRxiv - Microbiology 2022
Quote:
... The plates were developed with TMB (3, 3’, 5, 5’ - Tetramethylbenzidine) ELISA Peroxidase Substrate (Rockland Immunochemical, Limerick, PA), and absorbance was measured on a plate reader at 655 nm.
-
No products found
because this supplier's products are not listed.
Maria Jose Cabello-Lobato, et al.,
bioRxiv - Biochemistry 2021
Quote:
polySUMO2 chains (#ULC-220, Boston Biochem) were directly labeled with Cy3 following the manufacturer’s guidelines (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... IL-10 ELISA Kit (Interleukin 10) was purchased from Antibodies-online.com (Limerick ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Charlotte Scholtes, et al.,
bioRxiv - Cell Biology 2024
Quote:
... and mycoplasma contamination was regularly assessed using the polymerase chain reaction (PCR) mycoplasma detection kit (G238, ABM).
-
No products found
because this supplier's products are not listed.
Paul C Campbell, Christopher L de Graffenried,
bioRxiv - Microbiology 2023
Quote:
... anti-polyglutamate chain IN105 (1:10,000 for IF) (Adipogen), 20H5 (1:1000 for IF ...
-
No products found
because this supplier's products are not listed.
Harinath Doodhi, et al.,
bioRxiv - Cell Biology 2020
Quote:
Images of dynamic MTs were acquired by TIRF microscopy using Nikon Eclipse Ti-E (Nikon) inverted research microscope equipped with four diode lasers (405 nm ...
-
No products found
because this supplier's products are not listed.
Xin Su, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and 100μg of anti-Rat-kappa light chain (MAR18.5, BE0122; BioXCell) on day 1 ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Wenjuan Wang, et al.,
bioRxiv - Pathology 2024
Quote:
... neonates at age P2-P3 were injected subcutaneously with AAV-mt-Keima (Charles River, 1X1011 GC/pup), in which the expression of mt-Keima was driven by the CAG promoter ...
-
No products found
because this supplier's products are not listed.
Mehdi A. Fini, et al.,
bioRxiv - Immunology 2023
Quote:
... the intrinsic NADH fluorescence was observed through a 40x water immersion objective Zeiss Korr C-Apochromat NA 1.2 (Carl Zeiss, Jena, Germany) for monolayer cell culture ...
-
No products found
because this supplier's products are not listed.
Gregor Diensthuber, et al.,
bioRxiv - Genomics 2023
Quote:
... using 5-Methyluridine-5’-Triphosphate (5-mUTP, Trilink, N-1024-1) instead of UTP ...
-
No products found
because this supplier's products are not listed.
Kirandeep K. Deol, et al.,
bioRxiv - Biochemistry 2020
Quote:
Adenosine-5’-triphosphate (Goldbio, Cat. # A-081-5)
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
Prepared to contain higher collagenase and caseinase activities. A dialyzed, lyophilized powder.
Cat# LS005282,
1 gm, $246.00
Ask
Rui Tang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 5 mg Collagenase IV (Worthington), 25 U Dispase (Corning) ...
-
No products found
because this supplier's products are not listed.
K. Rashid Rumah, et al.,
bioRxiv - Microbiology 2019
Quote:
... cow and rat RBCs were all purchased from Innovative Research, Inc ...
-
No products found
because this supplier's products are not listed.
Natalie K. Horvat, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... MT-5 cell line were also transduced to stably express luciferase using LentifectTM (GeneCopoeia #LPP-HLUC-Lv105-025-C) lentiviral vectors of firefly luciferase ...
-
No products found
because this supplier's products are not listed.
Yasuaki Yanagawa, et al.,
bioRxiv - Microbiology 2019
Quote:
... histolytica antibody was detected using a commercially available ELISA kit (Entamoeba histolytica IgG-ELISA; GenWay Biotech, Inc., San Diego, CA. USA). All procedures were performed according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Sybille Koehler, et al.,
bioRxiv - Cell Biology 2020
Quote:
Urinary albumin levels were measured with a mouse albumin ELISA kit (ICL/Dunn Labortechnik GmbH ...
-
No products found
because this supplier's products are not listed.
Rebecca L. Wallings, et al.,
bioRxiv - Neuroscience 2023
Quote:
MHC II Ea chain (Ea) (52–68) peptide (Anaspec) was reconstituted in sterile distilled H 2O to a final concentrate of 1mG/mL ...
-
No products found
because this supplier's products are not listed.
Jiho Kim, et al.,
bioRxiv - Bioengineering 2023
Quote:
... the EVOM™ MANUAL Epithelial Volt/ohm meter (World Precision Instruments, EVM-MT-03-01) was employed ...
-
No products found
because this supplier's products are not listed.
Beáta B. Tóth, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The absence of mycoplasma was checked by polymerase chain reaction (PCR) analysis (PCR Mycoplasma Test Kit I/C, PromoCell cat# PK-CA91) [7,26].
-
No products found
because this supplier's products are not listed.
Janine Hochmair, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The emerging condensates and MT bundles were imaged on glass bottom imaging dishes (u-Slide Angiogenesis Glass bottom dishes, Ibidi) using a confocal spinning disc microscope (Eclipse-Ti CSU-X ...
-
No products found
because this supplier's products are not listed.
Yoojin Lee, Hye Jeong Cho, Han Min Woo,
bioRxiv - Synthetic Biology 2020
Quote:
... or α-glucosidase (Bottle 5 in the Maltose assay kit; Megazyme Inc., Wicklow, Ireland) (Fig ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Prasath Paramasivam, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 5 µg pre-miR-181a-1 were labeled with cy3 using Nucleic Acid Labeling Kit (Mirus) following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Evan M. Hess, et al.,
bioRxiv - Neuroscience 2022
Quote:
... supplemented with 5% fetal bovine serum/5% horse serum (Atlanta Biologicals), Glutamax (Gibco) ...
-
No products found
because this supplier's products are not listed.
Takahiro Yonekawa, et al.,
bioRxiv - Physiology 2021
Quote:
... and a mouse monoclonal antibody to a glycoepitope on the sugar chain of α-DG (IIH6; 1:100 dilution) followed by IRDye® 800CW dye-conjugated goat anti-sheep IgG (LI-COR, 926-32214) and goat anti-mouse IgM (LI-COR ...
-
No products found
because this supplier's products are not listed.
Lucia F. Zacchi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Two 5 L bioreactors (Sartorius) were seeded at 0.3 x 106 cells/mL in 3 L (total working volume ...
-
No products found
because this supplier's products are not listed.
Rediet Zewdu, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Animal Tissue RNA Purification Kit (Norgen Biotek) was used instead ...