-
No products found
because this supplier's products are not listed.
Ankita Datey, et al.,
bioRxiv - Microbiology 2019
Quote:
The serum samples were also subjected to indirect ELISA to detect the presence of IgG antibodies against JEV using Porcine JE IgG ELISA Kit (Glory Science Co., Ltd, USA) in accordance with the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Srideshikan Sargur Madabushi, et al.,
bioRxiv - Cancer Biology 2019
Quote:
The mouse and humanized anti-human CD33 mAb were conjugated with the metal chelator 1,4,7,10-tetraazacyclododecane-N,N′,N′′,N′′′-tetraacetic acid (NHS-DOTA; Macrocyclics, Dallas, TX) as previously described (12) ...
-
No products found
because this supplier's products are not listed.
Aggeliki Tserga, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Urinary albumin concentration was measured by ELISA using the AlbuWell kit (WAK-Chemie Medical GmbH, Steinbach, Germany). Urinary creatinine concentration was measured by the colorimetric method of Jaffe ...
-
No products found
because this supplier's products are not listed.
Filipy Borghi, et al.,
bioRxiv - Physiology 2021
Quote:
... 4 °C and analyzed using the commercial ELISA kit (Diagnostics Biochem Canada Inc. - Ref CAN-C-290) at the Laboratory of Stress Studies (LABEEST ...
-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Hannah J. Larsen, et al.,
bioRxiv - Physiology 2022
Quote:
... Arachidonic Acid (P/N 390) and ADP (P/N 384) were purchased from Chrono-Log Corporation ...
-
No products found
because this supplier's products are not listed.
Pierre-Louis Hollier, et al.,
bioRxiv - Physiology 2020
Quote:
... or rec N-Shh (Shenandoah biotechnology) diluted in 10 μL sterile phosphate-buffered saline (PBS ...
-
No products found
because this supplier's products are not listed.
Xiaoyi Zheng, et al.,
bioRxiv - Immunology 2021
Quote:
We quantified human serum Esm-1 by ELISA (Lunginnov, Lille, France) and mouse plasma Esm-1 by ELISA (Aviscera Biosciences, Santa Clara, CA), following the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Miriana Battista, et al.,
bioRxiv - Microbiology 2023
Quote:
... The level of interleukin (IL)-6 and tumor necrosis factor (TNF)-α was also quantified by Human IL-6 and TNF-α ELISA Kits (ImmunoTools), respectively.
-
No products found
because this supplier's products are not listed.
Tomoya Niinae, Yasushi Ishihama,
bioRxiv - Biochemistry 2023
Quote:
... A coupling system using 1-((Dimethylamino)(dimethyliminio)methyl)-1H-[1,2,3]triazolo[4,5- b]pyridine 3-oxide hexafluorophosphate/N,N-diisopropylethylamine was employed for the introduction of F2Pmp (PEPTIDE INSTITUTE, INC., Osaka, Japan) and a coupling system using 1-hydroxybenzotriazole/2-(1H-Benzotriazole-1-yl)-1,1,3,3- tetramethyluronium hexafluorophosphat/N,N-diisopropylethylamine was employed for the introduction of all other amino acids and a biotin PEG2 acid (Broad Pharm ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Matthew S. Yorek, et al.,
bioRxiv - Microbiology 2019
Quote:
... HV or analytical column through a microcross assembly (IDEX, P/N UH-752). Peptides are desalted on the trap using 16μl mobile phase A for 4 min ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Following secondary antibodies were used: monoclonal N- and S- specific IgG antibodies (Hytest, rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
De-Sheng Ker, et al.,
bioRxiv - Biophysics 2020
Quote:
The purified N protein was prepared on UltraAuFoil R1.2/1.3 gold support grids (Quantifoil). 3 µl of sample was applied to glow-discharged grids ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
Cat# AB-T024,
50 microliters,USD $330.0
Ask
Yue Li, Edmund Hollis II,
bioRxiv - Neuroscience 2021
Quote:
... anti-p75 conjugated saporin (p75-saporin) or IgG-saporin control (n = 8 / group, Advanced Targeting Systems) was diluted to final concentration of 0.4 mg/ml in normal saline ...
-
No products found
because this supplier's products are not listed.
Livia Mazzini, et al.,
bioRxiv - Immunology 2020
Quote:
ELISA plates were coated with 1µg/mL of purified recombinant Spike S1 Protein (aa 18-676) (eEnzyme, Gaithersburg, MD, USA) or with 1µg/mL Spike-RBD (Arg319-Phe541 ...
-
No products found
because this supplier's products are not listed.
Burt M Sharp, Qin Jiang, Panjun Kim, Hao Chen,
bioRxiv - Neuroscience 2023
Quote:
... 2-(3-(4-chloro-3-fluorophenyl)-5-ethyl-1H-1,2,4-triazol-1-yl)-N-(3,5-di-chlorobenzyl)acetamide (MR-L2) was from Targetmol Chemicals ...
-
FITC conjugated recombinant Mouse Kit (NP_001116205.1) extracellular domain (Met 1-Thr 523),...
Cat# Kit-4037MF,
50ug , USD $1298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Sarah Muniz Nardeli, et al.,
bioRxiv - Plant Biology 2023
Quote:
... with 3% BSA in PBS and the other with anti-Tubulin (1/10000 Agrisera cat. n° AS10-680) in 3% skimmed milk in PBS for two hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Daniel Roderer, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... were immobilized on commercial N-hydroxysuccinimide (NHS) ester-activated microarray slides (CodeLink Activated Slides; SurModics, Eden Prairie, MN, USA) using a piezoelectric spotting device (S3 ...
-
No products found
because this supplier's products are not listed.
Prabu Karthick Parameshwar, et al.,
bioRxiv - Biophysics 2024
Quote:
... the gels were activated twice with 0.1 mg/ml of the photoactivable bifunctional crosslinker N-sulfosuccinimidyl-6-[4’-azido-2’-nitrophenylamino] hexanoate (sulfo-SANPAH, ProteoChem); and incubated with an excess amount of 80-100 μl of bovine Collagen ı (0.1 mg/ml in phosphate buffered saline or PBS ...
-
No products found
because this supplier's products are not listed.
James Young, et al.,
bioRxiv - Microbiology 2019
Quote:
... or 12 h light/12 h dark cycle in ASPII N+ or ASP II N- (nitrogen-containing or nitrogen-free media) were transferred into a 20-ml glass serum bottle (Wheaton) respectively ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Bijoya Sen, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Blood was collected from healthy donors (N=5) and PBMCs were isolated using Lymphoprep™ (Alere Technologies AS, Oslo, Norway) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Gabriella T. Heller, et al.,
bioRxiv - Biophysics 2020
Quote:
... recombinant Aβ42 peptide (the 42-residue variant lacking the N-terminal M, see ‘Preparation of recombinant Aβ peptides’) was purchased from rPeptide and prepared following the manufacturer’s instructions ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Caroline S. Cencer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... CL4 and CACO-2BBE cells were grown to n days post-confluent (DPC) on acid-washed 22×22 mm #1.5H coverslips (Globe Scientific) in a 6-well plate to a time point with apical polarity representative of their native tissue ...
-
No products found
because this supplier's products are not listed.
Emmanuela Adjei-Sowah, et al.,
bioRxiv - Bioengineering 2023
Quote:
... GPC measurements were performed on a Shimadzu 20A GPC system equipped with a TSKgel SuperHM-N and complementary guard columns from Tosoh Bioscience ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... VWF antigen (Ag) (N: 50-150 IU/dL) was measured using the automated STA-Liatest VWF:Ag® (Diagnostica Stago, Asnières-sur-Seine, France). ADAMTS13 activity (N ...
-
No products found
because this supplier's products are not listed.
Lisa G.M. van Baarsen, et al.,
bioRxiv - Immunology 2021
Quote:
... synovial tissue was quickly homogenized on ice in 1 ml STAT-60™ solution using an IKA T10 basic homogenizer (S 10 N 5-G probe; 3304000, Cole-Parmer, USA). The homogenized tissue suspension was transferred to a clean RNAse-free tube and incubated at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Vivek Jani, et al.,
bioRxiv - Biophysics 2023
Quote:
... incubated for 1 minute in rigor buffer with the fluorescent ATP analog 25 μM 2’-/3’-O-(N’-Methylanthraniloyl) adenosine-5’-O-triphosphate (a.k.a. mant-ATP, Enzo Life Sciences, Axxora LLC, Framingham, NY), and moved to room temperature relaxing buffer ...
-
No products found
because this supplier's products are not listed.
Ayodeji B. Oyenihi, et al.,
bioRxiv - Microbiology 2024
Quote:
... Historical vaginal specimens (n = 946) marked for disposal were received in OneSwab® (Copan Diagnostics, CA, USA) or ThinPrep® (Hologic, MA, USA) transport media in a Clinical Laboratory Improvement Amendments (CLIA)-certified infectious disease laboratory facility between January and June 2023 and stored at −80 °C were selected randomly for this study ...
-
No products found
because this supplier's products are not listed.
Peter H. Yoon, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and titered using the baculovirus titering kit (Expression Systems) and Attune NxT Flow Cytometer with an autosampler ...
-
No products found
because this supplier's products are not listed.
Hyungmin Jun, et al.,
bioRxiv - Biophysics 2020
Quote:
... 5nm OligoREADY Gold Nanoparticle Conjugation Kit was purchased from Cytodiagnostics Inc ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...
-
No products found
because this supplier's products are not listed.
Assia Tiane, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using the Zymo Research EZ DNA Methylation-Direct Kit (BaseClear Lab Products). PCR primers were designed using the PyroMark Assay Design 2.0 software (Qiagen ...
-
No products found
because this supplier's products are not listed.
Masahide Sakabe, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Neonatal rat cardiomyocyte culture was performed using the neonatal cardiomyocyte isolation kit (Cellutron). P2 neonatal cardiomyocytes were plated on tissue culture dishes pre-coated with SureCoat (Cellutron ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Clotilde Laussel, et al.,
bioRxiv - Genetics 2022
Quote:
... The assay was performed using the 2DG uptake measurement kit (Cosmo Bio USA, Carlsbad ...
-
No products found
because this supplier's products are not listed.
Misato Okamoto Miyakawa, Hitoshi Miyakawa,
bioRxiv - Evolutionary Biology 2022
Quote:
... Samples were prepared using a CyStain UV Precise P Kit (Sysmex Partec., GmbH.). Each body ...
-
No products found
because this supplier's products are not listed.
Claire Raynaud, et al.,
bioRxiv - Microbiology 2021
Quote:
... We tested a range of commercially available kits (Molecular Dimensions, Hampton Research and Rigaku Reagents), which yielded a number of hits ...
-
No products found
because this supplier's products are not listed.
Cassandra Velasco, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... PCR master mixes were decontaminated with double-stranded DNAse treatment (PCR decontamination kit, Arcticzymes, Tromsø, Norway). Sterile water was processed using the same procedure as a negative control ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Concepcion Manzano, et al.,
bioRxiv - Plant Biology 2022
Quote:
... RNA was extracted with the Direct-zol RNA MiniPrep Plus kit (Neta Scientific Cat no RPI-ZR2053). cDNA libraries were made with the QuantSeq 3′ mRNA-Seq Library Prep kit from Lexogen (Cat no 015 QuantSeq FWD 3’ mRNA-Seq Library Prep Kit – with single indexing) ...
-
No products found
because this supplier's products are not listed.
Rowena Schultz, et al.,
bioRxiv - Cell Biology 2020
Quote:
... every 20th slide was stained with periodic acid-Schiff-hematoxylin (K047 kit, Poly Scientific RD, Bayshore NY USA) to show basal laminar deposit ...