-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Amanda M. Robinson, et al.,
bioRxiv - Immunology 2021
Quote:
... plate identifier sequence (RPI) and sequencing of 3’ UTRs ...
-
No products found
because this supplier's products are not listed.
Vanessa Meier-Stephenson, et al.,
bioRxiv - Biophysics 2021
Quote:
... ELISA plates were prepared using HBsAg capture Ab (Fitzgerald Industries International ...
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... IL-10 ELISA Kit (Interleukin 10) was purchased from Antibodies-online.com (Limerick ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Sonali Jindal, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... followed by chemiluminescent substrate (Protein Simple # PS-CS01, Luminol-S, Peroxide). Protein separation and signal detection utilized the WES system (Protein Simple ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
Heather Schiller, et al.,
bioRxiv - Microbiology 2023
Quote:
... Pop-out transformants were selected on agar plates containing 5-fluoroorotic acid (FOA) (Toronto Research Chemicals Inc.) at a final concentration of 50 μg mL-1 ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Agnieszka Szmitkowska, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and grown on vertically oriented plates for five more days prior to imaging with the Axiolab 5 (Carl Zeiss Microscopy, GmbH). To determine the AHK5-dependent ethylene effect on the root cap ...
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
Kiryl D. Piatkevich, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Five voltage pulses (50 V, 50 ms duration, 1 Hz) were delivered using 5 mm round plate electrodes (ECM™ 830 electroporator, Harvard Apparatus), placing anode or cathode on the top of the skull to target cortex or hippocampus ...
-
No products found
because this supplier's products are not listed.
Simone Vormittag, et al.,
bioRxiv - Microbiology 2022
Quote:
... infected cells (including supernatant) were collected from the 6-wells plate, centrifuged (500× g, 5 min, RT) and fixed with 4% PFA (Electron Microscopy Sciences) for 30min at RT ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Stahl, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Maikke B. Ohlson, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-EU was labeled in permeabilized cells using the Click & Go Kit (Click Chemistry Tools #1263) with 2 μM Alexa Fluor 488 azide (Click Chemistry tools #1275 ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Rainbow Calibration particles (RCP-60-5-2, RCP-60-5-5) were obtained from Spherotech. FITC and PE stained beads were part of the three color BD CaliBRITE kit (BD Biosciences 340486) ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
... black walled 96-well plates (0.5-1.5×104 cells/well) and Cell Navigator™ Lysosome Staining Kit (AAT Bioquest) was used according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Mark W. Zimmerman, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Antibody bound membranes were incubated with SuperSignal West Pico chemiluminescent substrate (Thermo-Fisher) and developed using HyBlot CL autoradiography film (Thomas Scientific). The antibodies used immunoblotting are listed in Table S3.
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lucy Nevard, et al.,
bioRxiv - Biophysics 2021
Quote:
... to transduce the vibrations to the flower by fixing a metal rod to the vibrating plate of the speaker and attaching a pair of very fine tipped forceps (Fine Science Tools, Dumont #5 Biology Tip Inox Forceps) to the end of the rod ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
John K. Mich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... the following primers were used: (5’-GGTTTCCCGCAGAACCTGAA-3’) and (5’-CCATCGCTCGACCAGTTTAGT-3’) (Jackson Laboratories)
-
No products found
because this supplier's products are not listed.
Kathrin S. Jutzeler, et al.,
bioRxiv - Microbiology 2024
Quote:
... We infected 5 female BALB/c and 5 female C57BL/6 mice (Envigo, 7-9 weeks old) per parasite population with 50 cercariae via tail immersion [26] ...
-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Hannah Donnelly, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Enzyme-linked immunosorbent assays (ELISA) was then carried out as per manufacturer’s instructions (R&D Systems, BMP-2 DuoSet ELISA kit, DY355). Briefly ...
-
No products found
because this supplier's products are not listed.
Tania J. Lebratti, et al.,
bioRxiv - Immunology 2020
Quote:
... IL-18 was measured using the mouse IL-18 ELISA kit (MBL International) according to manufacturer’s instructions at half-volumes.
-
No products found
because this supplier's products are not listed.
Sarah E. Wolf, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... We conducted qPCR on 384-well plates (ABI Quantstudio 5, Foster City, CA). For each sample ...
-
No products found
because this supplier's products are not listed.
Jan Stephan Wichers, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The chemiluminescent signal of the horseradish peroxidase-coupled secondary antibodies (Dianova) was visualized using a Chemi Doc XRS imaging system (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Tao Ni, et al.,
bioRxiv - Microbiology 2022
Quote:
... Seeding cells were maintained in liquid ATCC medium 290 or on ATCC 290 1.5% agar plates and inoculate in the Vishniac and Santer medium 40 in a 5-liter fermenter (BioFlo 115, New Brunswick Scientific, US) and were kept at constant pH 7.6 through supplement of 3 M KOH ...
-
No products found
because this supplier's products are not listed.
Erin E. Price, et al.,
bioRxiv - Microbiology 2021
Quote:
... two microliters of the cell suspension were spotted onto TSA plates containing 5% defibrinated rabbit blood (HemoStat Laboratories). For lipase assays ...
-
No products found
because this supplier's products are not listed.
Stefan J.A. Remmers, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Each bioreactor was placed in an incubator (37 °C, 5 % CO2) on a magnetic stirrer plate (RTv5, IKA, Germany) rotating at 300 RPM [24] ...
-
BIONOVA X Bioprinting multi-well plates are the key to high throughput DLP printing. Available...
Cat# D16110025295,
12 well, USD $285.0
Ask
Patrick Carmody, et al.,
bioRxiv - Biochemistry 2023
Quote:
... in a humidified incubator containing 5% CO2 at 37°C on culture plates coated with PureCol purified bovine collagen (Advanced BioMatrix, Carlsbad, CA). CFBE41o-cells were transfected using Lipofectamine 3000 (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Nir Salinas, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Incubated bacteria (5 μl) were dispersed on 5×5 mm silicon wafers (Ted Pella, USA) that had been prewashed with ethanol ...
-
No products found
because this supplier's products are not listed.
Uriel López-Sánchez, et al.,
bioRxiv - Biochemistry 2024
Quote:
... solubilized at 5 mg/mL in 5% DDM (Anatrace). After 30 minutes incubation ...
-
No products found
because this supplier's products are not listed.
Anita K. Nivedha, et al.,
bioRxiv - Biophysics 2021
Quote:
... 96-well white plates (BrandTech). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Costanza Borrelli, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 96 or 384 well plates were coated with rat tail collagen with the Collagen-I Cell Culture Surface Coating Kit (ScienCell Research Laboratories) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adam Taheraly, et al.,
bioRxiv - Microbiology 2023
Quote:
... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
No products found
because this supplier's products are not listed.
Ana Sousa-Ortega, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... mounted in FluoroDish 35 mm plates (WPI) and imaged in a Leica SP5 microscope using a 20x multi-immersion objective ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... QX-314 (5 mM, HelloBio) was added to the pipette solution.
-
No products found
because this supplier's products are not listed.
Sarah Hofmann, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 ug/ml insulin (PromoCell), 0.5 ug/ml Hydrocortisone ...
-
No products found
because this supplier's products are not listed.
Christopher J. Roome, Bernd Kuhn,
bioRxiv - Neuroscience 2020
Quote:
... head-plate stage and micromanipulator tower (Sutter Instruments), all mounted on a horizontally rotating stage (8MR190-90-4247 ...
-
No products found
because this supplier's products are not listed.
Shanlin Rao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% DOPS (Avanti Polar Lipids) was dried under a nitrogen stream and put under vacuum overnight ...