-
No products found
because this supplier's products are not listed.
Arnav Gupta, et al.,
bioRxiv - Genomics 2022
Quote:
... and IL-8 levels were quantified from streptavidin-Horseradish peroxidase associated with the detection antibody using absorbance read by an Infinite M1000 plate reader (Tecan).
-
No products found
because this supplier's products are not listed.
Marina P Volegova, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... anti-cleaved caspase 3 antibody (Biocare CP229A) at 1:250 dilution ...
-
No products found
because this supplier's products are not listed.
Monika Moissidis, et al.,
bioRxiv - Neuroscience 2024
Quote:
... to stain cells infected with adeno-associated viruses expressing mCherry or against GFP (using a combination of two rabbit anti-GFP antibodies, 1:500, Aves Labs #GFP-1020 and Abcam #ab13970) to reveal the endogenous GFP signal of MGE-derived cells labeled with an RCE reporter ...
-
No products found
because this supplier's products are not listed.
T S Sreevidya, et al.,
bioRxiv - Biophysics 2021
Quote:
The thermal and chemical denaturation of the WT and the mutant 14-3-3 proteins were performed using nano-DSF (Prometheus NT.48) from Nanotemper Technologies (Munchen ...
-
No products found
because this supplier's products are not listed.
Vu Thuy Khanh Le-Trilling, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Proteins were visualised using peroxidase-coupled secondary antibodies (Dianova) and the ECL chemiluminescence system (Cell Signaling).
-
No products found
because this supplier's products are not listed.
Wafaa B. Alsoussi, et al.,
bioRxiv - Immunology 2022
Quote:
... and antibody was purified using protein A agarose chromatography (Goldbio). Sequences were obtained from PCR reaction products and annotated using the ImMunoGeneTics (IMGT)/V- QUEST database (http://www.imgt.org/IMGT_vquest/)51,52 ...
-
No products found
because this supplier's products are not listed.
Zhongxia Yi, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... FLAG proteins were eluted for 10-20 mins with 250 ug/ml 3× FLAG peptide (APExBIO) in Isotonic Wash Buffer at 37°C ...
-
No products found
because this supplier's products are not listed.
Jennifer Kreis, Fee M. Wielath, Philipp Vick,
bioRxiv - Developmental Biology 2020
Quote:
... and general Reverse_5’-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCT ATTTCTAGCTCTAAAAC -3’ Embryos were injected with 1 ng Cas9 protein (PNA Bio) and 300 pg sgRNA at 1-cell stage and cultivated at room temperature until desired stage ...
-
No products found
because this supplier's products are not listed.
Mie Suzuki-Okutani, et al.,
bioRxiv - Microbiology 2024
Quote:
... IgG1 and IgG2/3 subclass Abs were analyzed using biotinylated subclass-specific antibodies (Southern Biotech, 1/100 and 1/200000 dilutions ...
-
No products found
because this supplier's products are not listed.
Christoph Gerdes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Micropipette tips were sharpened at an angle of 20-30° until the pipette tip had a syringe-like shape (Micropipette Beveler 48000; World Precision Instruments). Micropipettes were filled with 3 μl of plasmid solution/s (600 ng/μl) ...
-
No products found
because this supplier's products are not listed.
Thomas R. Gawriluk, et al.,
bioRxiv - Immunology 2019
Quote:
... and given autoclaved water and a 3:1 mixture by volume of 14% protein mouse chow (Teklad Global 2014, Envigo) and black-oil sunflower seeds (Pennington Seed Inc. ...
-
No products found
because this supplier's products are not listed.
Claire Seydoux, et al.,
bioRxiv - Plant Biology 2021
Quote:
Antibodies from guinea pig immunization with this purified protein product were obtained from Charles River biologics (USA).
-
No products found
because this supplier's products are not listed.
Jia-Shuo Yang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... fluo-3 acetoxymethyl (Fluo-3 thereafter) ester (Biotium, US) following a protocol adapted from (Zhang et al. ...
-
No products found
because this supplier's products are not listed.
Yanqi Yu, et al.,
bioRxiv - Biophysics 2021
Quote:
... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC) was purchased from Alfa Aesar (Haverhill, MA). Nigericin sodium salt was purchased from Tocris Bioscience (Minneapolis ...
-
No products found
because this supplier's products are not listed.
Chien-Wei Wang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-CA125 epitope group A (Fitzgerald, OC125-like, M61704, 1:2000), anti-CA125 epitope group B (Agilent ...
-
No products found
Sowmya Gunasekaran, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Adeno-associated virus (AAV) was purchased from Applied Biological Materials (abm). AAV-mir-GFP-Blank Control Virus (Serotype 8 ...
-
No products found
because this supplier's products are not listed.
Gang Wang, et al.,
bioRxiv - Microbiology 2021
Quote:
... ACE2 protein primary antibody (BOSTER, Lot#BST19874624) and β-actin protein primary antibody (ABclonal ...
-
No products found
because this supplier's products are not listed.
Ayush Aditya Pal, et al.,
bioRxiv - Bioengineering 2022
Quote:
... cells were seeded in 96- or 384-well plates (Cellvis 96-well plate with glass-like polymer bottom, catalog number P96-1.5P; Greiner Bio-One CELLSTAR 384-well ...
-
No products found
because this supplier's products are not listed.
Marie-Dominique Jolivet, et al.,
bioRxiv - Plant Biology 2023
Quote:
... 6His-AtREM1.21–118 was produced like GST-CPK and purified on Protino® Ni-TED column following manufacturer’s instructions (Macherey-Nagel). After elution with 40-250 mM imidazole ...
-
No products found
because this supplier's products are not listed.
Hannah Wapenaar, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and HRP conjugated secondary antibody, PonceauS (3% trichloroacetic acid, 3% sulfosalicylic Acid, 0.2% Ponceau) or stainfree gels (Mini-PROTEAN TGX Stain-Free Precast Gels).
-
No products found
because this supplier's products are not listed.
Christine R. Pye, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Spectra were acquired using a 700MHz Bruker Avance III spectrometer (Bruker Corporation, Billerica, Massachusetts, USA) with associated triple resonance inverse (TCI) cryoprobe and chilled Sample Jet auto-sampler ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
Cat# HY-P70054-50 μg,
50 μg, USD $345.0
Ask
Yanli Chang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3mM 3-Methyladenine(3-MA, MedChemExpress, HY-19312) and 80μM dynasore (MedChemExpress,HY-15304) ...
-
No products found
because this supplier's products are not listed.
Madhu Tiwari, et al.,
bioRxiv - Plant Biology 2021
Quote:
... The VirE2 protein was detected by the anti-VirE2 polyclonal antibody (G-Biosciences, 1:10000) and anti-rabbit secondary antibody (Sigma ...
-
No products found
because this supplier's products are not listed.
Anne Trinh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Amino acids concentration assay (μmol/l) was performed by high-performance liquid chromatography (Shimadzu C18 column, Kyoto, Japan) associated with tandem mass spectrometry (Sciex 3200 Qtrap, Framingham, MA) using the aTRAQ kit for amino acid analysis of physio-logical fluids (Sciex) ...
-
No products found
because this supplier's products are not listed.
Chunru Wei, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The eluted proteins were subjected to immunoblot analysis with anti-FLAG tag polyclonal antibody (Solarbio, China). The detailed Co-IP was performed as described by Zhu and Huq [28].
-
No products found
because this supplier's products are not listed.
Marion Thépaut, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Proteins were detected using InstantBlue protein stain (Expedeon) according to the supplier’s instructions.
-
Building Block
Sold for research purposes only.
Cat# 2592.0, SKU# 2592-1000 mg,
1000mg, US $165.00 / EA, EURO, €150 / EA
Ask
Edinson Lucumi Moreno, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 M CHIR (Axon Medchem) and 150 M Ascorbic Acid (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Muaz Nik Rushdi, et al.,
bioRxiv - Immunology 2022
Quote:
... The purified proteins were biotinylated using biotin protein ligase (Avidity); excess biotin and ligase were removed with a Superdex 200 column (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Suman Khan, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10.8% Drug Like Set (Enamine, Ukraine), 26.8% DiversetCL (Chembridge ...
-
No products found
because this supplier's products are not listed.
Sophie J. Hesketh, et al.,
bioRxiv - Cell Biology 2022
Quote:
For stable expression of mScarlet (mSc) tagged IFT-A proteins (IFT144, IFT140, IFT122, IFT121, and IFT139) and associated mutants using the Super PiggyBac system (System Biosciences), the relevant open reading frames were inserted into the PB-EF1α-MCS-IRES-Neo vector with C-terminal TEV ...
-
No products found
because this supplier's products are not listed.
Heather M. Forsythe, et al.,
bioRxiv - Biophysics 2019
Quote:
... The plasmid containing the gene for human γS WT was engineered into the pE-SUMO (Small Ubiquitin-like Modifier) vector containing a N-terminal 6XHis tagged fusion protein (LifeSensors Inc., Malvern, PA). The γS N14D and γS N76D were generated via site-directed mutagenesis using QuikChangeXL Kit (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Stuti Mehta, et al.,
bioRxiv - Molecular Biology 2022
Quote:
AAVPrime™ Adeno-associated virus (AAV) Serotype Testing Kit (GeneCopoeia) was used to determine the efficiency of 8 different AAV serotypes in infecting the HCC1187 cell line ...
-
No products found
because this supplier's products are not listed.
Ariën Schiepers, et al.,
bioRxiv - Immunology 2022
Quote:
... 16-nucleotide barcodes were associated with their BA.1 variants by PacBio sequencing ...
-
No products found
because this supplier's products are not listed.
Douek-Maba Orit, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... followed by an overnight incubation at 4°C in blocking solution with anti phospho-histone 3 (PhH3) antibody or anti-caspase 3 (Cas3) antibody (both 1:300; Lifespan Bioscience. Washington US). Next ...
-
No products found
because this supplier's products are not listed.
Elsa Obergfell, et al.,
bioRxiv - Plant Biology 2023
Quote:
... The elution fractions containing the trxA-14-3-3 or trxA-BIN2 fusion proteins were loaded onto a 5 ml Strep-Tactin Superflow High Capacity column (IBA Lifesciences), washed with buffer A and eluted in buffer A supplemented with 2.5 mM desthiobiotin ...
-
No products found
because this supplier's products are not listed.
Xu Dong, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibody information is as follows: Actived-Caspase-3 p17 polyclonal antibody (BS7004; Bioworld, USA; 1: 500) Cleaved Caspase-8 (Asp391 ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... torque teno virus hypothetical protein or human respirovirus 3 D protein were transfected into the cells using TransIT-LT1 (Mirus Bio) according to manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Ezarul Faradianna Lokman, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Plasma was used for analyte analysis (Ghrelin, glucagon like peptide (GLP-1) and glucagon) using ELISA kit (Elabscience, China).
-
No products found
because this supplier's products are not listed.
Paula García-Huerta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Samples were probed with primary antibodies: Ataxin-3 (Aviva Systems Biology; Cat#ARP50507_P050), βIII-tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
George Cameron, et al.,
bioRxiv - Biophysics 2022
Quote:
... Anti-GINS antibody was affinity purified using protein A-sepharose (Covalab). For bulk replication assays ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Minghao Chen, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 3 μl of protein solution was applied onto a grid freshly glow-discharged in PELCO easiGlow system (Ted Pella). In-house graphene grids were prepared from Trivial Transfer Graphene sheets (ACS Material ...
-
No products found
because this supplier's products are not listed.
Natalya Leneva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... with 3 mol% of dipalmitoyl-phosphatidylinositol-3-phosphate (PI(3)P) (Echelon Biosciences) were prepared at a lipid concentration of 0.5 mg/ml in Buffer A by extrusion through a 0.4 μm polycarbonate filter (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Michelle Wantoch, et al.,
bioRxiv - Immunology 2020
Quote:
... 96 well plates were coated with a mixture of antibodies against IFN-α (Mabtech, MT1/3/5) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Daan Vorselen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... BSA-functionalized DAAM-particles were washed 3× in sterile PBS and opsonized with 0.02 - 0.05 mg/mL rabbit anti-BSA antibody (MP Biomedicals, 0865111) for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...