-
No products found
because this supplier's products are not listed.
K. Saini, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... (3Helix, Inc., B-CHP) and fluorescent Streptavidin conjugate Alexa-594 (Thermofisher -S11227 ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Kiryu K. Yap, et al.,
bioRxiv - Cell Biology 2023
Quote:
Human coagulation factor VIII levels in the mouse plasma were measured using a factor VIII enzyme-linked immunosorbent assay (ELISA) kit (Affinity Biologicals), following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Aric N. Brown, et al.,
bioRxiv - Microbiology 2023
Quote:
... Polymyxin B (RPI Lot# 85594-90055) was added to cells triplicate96-well plates at a final concentration of 5.0µg/mL (C ...
-
No products found
because this supplier's products are not listed.
Thomas Keating, et al.,
bioRxiv - Immunology 2021
Quote:
... IgG-depleted exogenous pooled human complement was pre-incubated for 20 minutes at 4°C with PBS (control) or mouse anti-human C1q mAb (Hycult Biotech, Netherlands) at 1/5 dilution ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... alternative complement pathway activity and total immunoglobulin M levels were measured in triplicate using a microplate reader (Synergy HT, Biotek, Winooski, Vermont, USA).
-
No products found
because this supplier's products are not listed.
Zohreh Izadifar, et al.,
bioRxiv - Bioengineering 2023
Quote:
... supplemented with cervical growth factors (LifeLine Cell Technology, SKU:LL-0072) and 50 U/ml Penicillin-Streptomycin (GibcoTM ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Adam Myszczyszyn, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 125 µg/ml Amphotericin B (Biomol). Whole kidneys were minced into pieces smaller than 1 mm3 ...
-
No products found
because this supplier's products are not listed.
Gabriele Flossmann, et al.,
bioRxiv - Genomics 2020
Quote:
... Library preparation followed ultrasonic fragmentation (Covaris: 50 s, 5% duty factor) using the Illumina TruSeq DNA PCR-Free Sample Preparation Kit with an insert size of 350 bp ...
-
No products found
because this supplier's products are not listed.
Xufeng Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... Group 2: Polymyxin B (PMB) (1 mg/kg, i.p., Solarbio, China); Group 3 ...
-
No products found
because this supplier's products are not listed.
Patricia A Blundell, et al.,
bioRxiv - Immunology 2019
Quote:
Native influenza B Hong-Kong 5/72 was obtained from Meridian Life Sciences. To determine the optimal virus-to-erythrocyte ratio ...
-
No products found
because this supplier's products are not listed.
Rafael E. Sanchez-Pupo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Granzyme B imaging was performed in an LSM 800 Confocal Microscope (Carl Zeiss) using a Plan-Apochromat LCI Plan-Neofluar 25x (0.8 Imm Korr Water DIC ...
-
No products found
because this supplier's products are not listed.
Lyudmila Shalamova, et al.,
bioRxiv - Microbiology 2022
Quote:
... 500 or 1000 U/ml pan-species IFN-alpha (B/D) (PBL Assay Science) and infected at an MOI of 0.01 ...
-
No products found
because this supplier's products are not listed.
Manuel Albanese, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human primary B cells were prepared from adenoidal mononuclear cells by Ficoll Hypaque (PAN Biotech) gradient centrifugation (as described in Albanese et al. ...
-
No products found
because this supplier's products are not listed.
Vikas Arige, et al.,
bioRxiv - Physiology 2022
Quote:
... The IP3R1 antibody (#ARC154, Antibody Research Corporation) was used at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
B Cuypers, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... according to LeBowitz (1994) (53) and selected in vitro by adding 50 μg/mL hygromycin B (JENA Bioscience) until parasite growth (54) ...
-
No products found
because this supplier's products are not listed.
Nicole Nguyen, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and in primary antibody (α-tRFP, [mKate antibody, Evrogen, AB233] ...
-
No products found
because this supplier's products are not listed.
Boris Bonaventure, et al.,
bioRxiv - Microbiology 2021
Quote:
... or J2 anti-dsRNA antibody (SCICONS), or anti-SARS-CoV-2 Nucleoprotein (N ...
-
No products found
because this supplier's products are not listed.
Elena K Ruff, et al.,
bioRxiv - Neuroscience 2023
Quote:
11NQ antibody was labeled (Cisbio-Revvity) with Europium Cryptate (donor fluorophore ...
-
No products found
because this supplier's products are not listed.
Emily M. Sontag, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Anti-Nsp1 antibody from EnCor Biotechnology was used to visualize nuclear pores and Anti-Nsr1 antibody from Abcam was used for staining the nucleolus.
-
No products found
because this supplier's products are not listed.
MU Wagenhäuser, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... specific antibodies were used (Emfret Analytics, GPIb/CD42b ...
-
No products found
because this supplier's products are not listed.
Michael G. Spelios, et al.,
bioRxiv - Immunology 2021
Quote:
... A SARS-CoV-2 neutralization antibody (EpiGentek), which targets the spike RBD ...
-
No products found
because this supplier's products are not listed.
Juan Pablo Arroyo, et al.,
bioRxiv - Physiology 2022
Quote:
Antibody was developed with assistance from Phosphosolutions Inc ...
-
No products found
because this supplier's products are not listed.
Florian Wiede, et al.,
bioRxiv - Immunology 2019
Quote:
Serum anti-nuclear antibodies were detected with the mouse anti-nuclear antibodies Ig’s (total IgA+G+M) ELISA Kit from Alpha Diagnostic International ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and plasma was analyzed for anti-OVA total IgG antibodies using a mouse anti-OVA IgG antibody assay kit (Chondrex). On day 13 ...
-
No products found
because this supplier's products are not listed.
Marissa Lindman, et al.,
bioRxiv - Immunology 2023
Quote:
... IFNAR-1 monoclonal antibody (MAR1-5A3, Leinco Technologies) or isotype control (GIR-208 ...
-
No products found
because this supplier's products are not listed.
Panagiotis E. Eleftheriadis, et al.,
bioRxiv - Neuroscience 2022
Quote:
Antibodies used: Rabbit anti CART (Phoenix Pharmaceuticals, G003-62), rabbit anti ChAT (Jessell lab ...
-
No products found
because this supplier's products are not listed.
Erin E. Henninger, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... α factor (Bachem) was added to a final concentration of 10-7 M and cultures were incubated for 130 minutes at 30°C ...
-
No products found
because this supplier's products are not listed.
Yannic C Bartsch, et al.,
bioRxiv - Immunology 2022
Quote:
... immune-complexes were incubated with guinea pig complement in GVB++ buffer (Boston BioProducts, MA, USA) for 20 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Yang-Hee Kim, et al.,
bioRxiv - Bioengineering 2023
Quote:
The quantification of bone morphogenetic growth factor (BMP)-2 and vascular endothelial growth factor (VEGF ...
-
No products found
because this supplier's products are not listed.
Kamran Bakhtiari, Joost C.M. Meijers,
bioRxiv - Biochemistry 2019
Quote:
... plasma-derived factor IX (Nonafact®, Sanquin, Amsterdam, the Netherlands), activated factor IX6 ...
-
No products found
because this supplier's products are not listed.
Shijie Cao, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Azide-labelled pHPMA-b-pBMA or pMAA-b-pBMA polymer was reacted with AFDye647-DBCO (Click Chemistry Tools) and then formulated into micelles ...
-
No products found
because this supplier's products are not listed.
Florent Peglion, et al.,
bioRxiv - Cell Biology 2021
Quote:
... VO-OHpic (Tebu-bio, Ref#B-0351), Compound C (CC ...
-
No products found
because this supplier's products are not listed.
Nadège Gouignard, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... at 100 μg/mL or Magenta-Phos (Biosynth, B-7452). The following probes were used ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Gabriel Antonio S. Minero, et al.,
bioRxiv - Microbiology 2023
Quote:
... and ds B-DNA in a CLARIOstar plate reader (BMG Labtech). Due to variations in fluorescence between samples ...
-
No products found
because this supplier's products are not listed.
Milena Petkova, et al.,
bioRxiv - Cell Biology 2022
Quote:
Mouse Vascular Endothelial Cell Growth Factor C (VEGF-C) ELISA Kit from CUSABIO (CSB-E07361m) was used for detection of VEGF-C protein concentration ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Quantitative analysis of the CFTR B and C-bands was performed using Compass software (Protein Simple).
-
No products found
because this supplier's products are not listed.
Soma Dash, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and Halo-tagged upstream binding factor (AICS-0086 cl.147) were plated on Matrigel coated Ibidi 35 mm µ-Dishes (Ibidi, #81156). The cells were then imaged using a CSU-W1 spinning disc (Yokogawa ...
-
No products found
because this supplier's products are not listed.
Aki Teranishi, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... with the primers 5’-GGGGAATTCGCCACCATGGGTTCTCA-3’ and 5’-CCC GCGGCCGCTCACTTCGCTGTCATCA-3’ was subcloned into EcoRI and NotI sites in the P B-CMV-MCS-EF1α-Puro PiggyBac transposon vector (PB510B-1, System Bioscience).
-
No products found
because this supplier's products are not listed.
Kishor Dnyaneshwar Ingole, et al.,
bioRxiv - Plant Biology 2020
Quote:
... or anti-Actin C3 antibodies (Abiocode)] in 1X TBST at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
Koji Ishikawa, Akari Ishihara, Hisao Moriya,
bioRxiv - Genetics 2019
Quote:
... and peroxidase-conjugated secondary antibody (Nichirei Biosciences) (1:1,000 ...
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... (ID Vet) and Influenza A Antibody ELISA (IDEXX) were performed according to manufacturers’ instructions.
-
No products found
because this supplier's products are not listed.
Marie-Françoise Montaron, et al.,
bioRxiv - Neuroscience 2020
Quote:
... one-in-ten sections were incubated with different anti-BrdU antibodies (BrdU & CldU, rat primary antibodies at 1/200 Accurate Chemical; IdU ...
-
No products found
because this supplier's products are not listed.
Cindy F. Yang, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-somatostatin-14 antibody (Peninsula Laboratories, Cat# T-4103.0050, RRID: AB_518614) was raised in rabbit against the first 14 aa of the synthetic peptide SST ...
-
No products found
because this supplier's products are not listed.
Ria Göttert, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were applied in the following concentrations: mouse anti-CD45 (EXBIO) 1:100 ...