-
No products found
because this supplier's products are not listed.
Sean G Rudd, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rabbit anti-cleaved PARP (#9541, Cell Signaling), mouse anti-PLK1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Jessica L. Rausch, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cleaved PARP (Abcam) and mono-ubiquitin (BD Pharmingen).
-
No products found
because this supplier's products are not listed.
Shrabastee Chakraborty, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... cleaved PARP (Santa Cruz Biotechnolgy); PTEN ...
-
No products found
because this supplier's products are not listed.
K Lankes, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and cleaved PARP (552596, BD Pharmingen) primary antibodies ...
-
No products found
because this supplier's products are not listed.
Brendan Farrell, et al.,
bioRxiv - Microbiology 2023
Quote:
... the eluted mAb was cleaved using Immobilised Papain (20341, Thermo Scientific). After cleavage ...
-
No products found
because this supplier's products are not listed.
Chueh-Hsuan Lu, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... cleaved PARP and GAPDH (GeneTex) were used ...
-
No products found
because this supplier's products are not listed.
Alessandra M. Norris, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rabbit anti-cleaved Caspse 3 (1:500, Millipore Sigma AB3623), and goat anti-PDGFRα (1:250 ...
-
No products found
because this supplier's products are not listed.
Jordan F. Hastings, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... total P53 and cleaved PARP (Biorad). The data was normalized to the median value at the 0 h time point for each analyte and a log transformation was conducted on the resulting dataset ...
-
No products found
because this supplier's products are not listed.
John T. Killian Jr., et al.,
bioRxiv - Immunology 2023
Quote:
... Recombinant human IgG1 mAbs were synthesized (Sino Biological) using the AA sequences derived from the predicted UCA nucleotide sequences.
-
No products found
because this supplier's products are not listed.
Michael D. Barnhart, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Cleaved recombinant protein was then purified on a MonoQ 5/50 GL column (GE Healthcare) using Buffer QA (described above + 1 mM DTT ...
-
No products found
because this supplier's products are not listed.
Miran Rada, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were subjected to antigen retrieval antigen retrieval (pH = 6.0 for cleaved caspase-3 and pH = 9.0 for cleaved PARP-1) followed by washing with PBS and incubation in hydrogen peroxide (Dako, #S2003) to inhibit endogenous peroxidase ...
-
No products found
because this supplier's products are not listed.
Swagatika Paul, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Optineurin Rabbit mAb (#10837-1-AP; Proteintech), NDP52 (60732 ...
-
No products found
because this supplier's products are not listed.
Zoya Mann, et al.,
bioRxiv - Cell Biology 2023
Quote:
Rabbit mAb against NMIIB (Biolegend, Cat#909901)
-
No products found
because this supplier's products are not listed.
Kristen E. Rohli, et al.,
bioRxiv - Cell Biology 2021
Quote:
... cleaved Caspase 3 (rabbit, R&D systems MAB835, 1:500), CPE (rabbit ...
-
No products found
because this supplier's products are not listed.
Thomas P. Peacock, et al.,
bioRxiv - Microbiology 2021
Quote:
Each peptide was tested for its ability to be cleaved by recombinant furin (10 U/mL; NEB; P8077) in a buffer of 100 mM HEPES ...
-
No products found
because this supplier's products are not listed.
Laurelle Jackson, et al.,
bioRxiv - Microbiology 2021
Quote:
... a rabbit anti-spike monoclonal antibody (mAb BS-R2B12, GenScript A02058) was used at 0.5μg/mL as the primary detection antibody ...
-
No products found
because this supplier's products are not listed.
Darrell R. Kapczynski, et al.,
bioRxiv - Microbiology 2021
Quote:
... and rabbit anti-Spike MAb (Origene), diluted as above ...
-
No products found
because this supplier's products are not listed.
Yuki Sato, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... rabbit anti-cleaved Caspase-3 (1:500 dilution, Promega), mouse anti-GFP (1:1,000 dilution ...
-
No products found
because this supplier's products are not listed.
Li-Feng-Rong Qi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... GRB2 Rabbit mAb (cat. No. A19059, ABclonal, China), ERK1/ERK2 Rabbit pAb (cat ...
-
No products found
because this supplier's products are not listed.
Hataf Khan, et al.,
bioRxiv - Microbiology 2020
Quote:
... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
No products found
because this supplier's products are not listed.
Ingrid R. Niesman,
bioRxiv - Cell Biology 2020
Quote:
... (Abcam; CHOP mAb #2895T, GFP rabbit mAb #2956T Novus Biologicals; TGN38 mAb #NB300-575SS ...
-
No products found
because this supplier's products are not listed.
Sarah Vogt, et al.,
bioRxiv - Plant Biology 2021
Quote:
The PARP activity assay was performed with the PARP Universal Colorimetric Assay Kit (Trevigen) according to the manufacturer’s manual ...
-
No products found
because this supplier's products are not listed.
Dorothea Höpfner, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Recombinant rabbit anti-pan-ADP-ribose binding reagent MABE1016 (Merck Millipore) was used 1:1000 ...
-
No products found
because this supplier's products are not listed.
Gil Henkin, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Uncleaved protein and cleaved His6-Ztag domains were separated from cleaved protein by incubation with TALON resin (Clontech). The supernatant was buffer exchanged to MES A buffer (20 mM MES ...
-
No products found
because this supplier's products are not listed.
Anngela C. Adams, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... κ isotype control mAb (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Eloise Clarkson, Annabelle Lewis,
bioRxiv - Cancer Biology 2024
Quote:
... 1% mouse recombinant EGF (Invitrogen, 5% Recombinant human R-spondin (Peprotech).
-
No products found
because this supplier's products are not listed.
Nina Kirstein, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit anti-H4K20me3 (Diagenode, MAb-057-050), or IgG isotype controls for 16h at 4°C ...
-
No products found
because this supplier's products are not listed.
Clément Demongin, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Primary antibodies for FUS (α-FUS rabbit, mAB ABnova) and TDP-43 (α-TDP-43 mousse ...
-
No products found
because this supplier's products are not listed.
Sridevi Challa, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
The custom rabbit polyclonal antiserum against PARP-1 was generated in-house by using purified recombinant amino-terminal half of PARP-1 as an antigen (now available Active Motif; cat. no. 39559). The custom recombinant antibody-like anti-poly-ADP-ribose binding reagent (anti-PAR ...
-
No products found
because this supplier's products are not listed.
Mohammad M. Sajadi, et al.,
bioRxiv - Immunology 2021
Quote:
... 0.5 μg/mL anti-CD40 mAb (Miltenyi Biotec) and CXCR5 antibody were added ...
-
No products found
because this supplier's products are not listed.
Kelsey Briggs, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... rabbit anti-Spike MAb (Origene, Rockland, Maryland), diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
André-Claude Mbouombouo Mfossa, et al.,
bioRxiv - Neuroscience 2020
Quote:
... anti-cleaved Caspase-3 (rabbit, 1:100, Biovision (3015-100)) ...
-
No products found
because this supplier's products are not listed.
Munevver Cinar, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... and NU1025 (PARP inhibitor VI) from Calbiochem. Quick Ligation Kit was purchased from New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Amanda M. Hamilton, et al.,
bioRxiv - Cell Biology 2019
Quote:
... and biotinylated anti-rabbit secondary antibody (for cleaved caspase-3, 1:2000, Vector Labs BA-1000) for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Junfei Xia, et al.,
bioRxiv - Bioengineering 2020
Quote:
... freshly cleaved mica (Ted Pella) was incubated with 20 μL of 100 m M NiCl2 for 1 min and rinsed with 50 mL ultrapure water ...
-
No products found
because this supplier's products are not listed.
Geoffrey K. Herrmann, Y. Whitney Yin,
bioRxiv - Biochemistry 2020
Quote:
... PARP-1 was purified by sequential application to Ni-NTA agarose (Qiagen), HiTrap Heparin HP column (GE Healthcare) ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
... Mab MT57 (Mabtech), were absorbed on plates instead of spike antigen ...
-
No products found
because this supplier's products are not listed.
Krisztina Ötvös, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The purified recombinant protein was used to immunize rabbits by a company (Eurogentec). From the immunserum a crude IgG fraction was isolated by ammonium sulfate precipitation then IgG was further purified on protein gel blots of the antigen ...
-
No products found
because this supplier's products are not listed.
Martin Pauli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... rabbit polyclonal and mAb anti-Zinc transporter 3 (ZnT3) (Synaptic Systems 197 002 and 197 011, 1:500). Secondary antibodies were used in the following concentrations ...
-
No products found
because this supplier's products are not listed.
Kostantin Kiianitsa, Nancy Maizels,
bioRxiv - Biochemistry 2020
Quote:
... a rabbit polyclonal raised against recombinant PARP1 (Enzo Life Sciences ALX-210-302-R100; 1:4000 dilution); anti-N-ter-PARP1 ...
-
No products found
because this supplier's products are not listed.
Jing Fan, et al.,
bioRxiv - Cell Biology 2023
Quote:
PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
No products found
because this supplier's products are not listed.
Cansu Yildirim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant mouse IFNγ (Immunotools, #12343537), recombinant mouse IL4 (Immunotools ...
-
No products found
because this supplier's products are not listed.
Katarzyna Olga Rojek, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human recombinant VEGF-165 (Stemcell technologies; Saint Egrève ...
-
No products found
because this supplier's products are not listed.
Wai Tuck Soh, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-rat IgG-APC mAb (Jackson ImmunoResearch, West Grove, PA, USA).
-
No products found
because this supplier's products are not listed.
Nicholas A. W. Bell, et al.,
bioRxiv - Biophysics 2020
Quote:
... PARP inhibitors were purchased from Cayman Chemical and diluted in DMSO ...
-
No products found
because this supplier's products are not listed.
Andrea Bernardini, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... TAF10 (3 μg/mL, mouse mAb, 6TA 2B11), TBP (2 μg/mL, mouse mAb, 3TF1 3G3) or SUPT7L (rabbit pAb, Bethyl, A302-803A). A secondary-only control sample was incubated with BPS devoid of primary antibody ...
-
No products found
because this supplier's products are not listed.
Hsuan-Yuan (Sherry) Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... 2M7 mAb isolated from rabbit PBMCs was detected with an HRP-conjugated polyclonal mouse anti-rabbit IgG (Southern Biotech) and all the positive controls were detected with an HRP-conjugated polyclonal goat anti-human IgG (Southern Biotech ...
-
No products found
because this supplier's products are not listed.
Ivan Martinez-Valbuena, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Recombinant α-synuclein (rPeptide) was thawed from −80 ◦C storage ...
-
No products found
because this supplier's products are not listed.
Melissa Lim, et al.,
bioRxiv - Biochemistry 2024
Quote:
Recombinant DCAF16 (MyBioSource.com, MBS1375983) (0.1μg/sample ...
-
No products found
because this supplier's products are not listed.
Tania Christova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recombinant GST (SignalChem #G52-30U) and GST-LTK (SignalChem #L11-11G ...