-
No products found
because this supplier's products are not listed.
Eric J. Montemayor, et al.,
bioRxiv - Biochemistry 2020
Quote:
Codon optimized open reading frames (Genscript) for S ...
-
No products found
because this supplier's products are not listed.
Lei Li, et al.,
bioRxiv - Immunology 2021
Quote:
... The hACE2 open reading frame (Addgene# 1786) was cloned into a 3rd generation lentiviral expression vector pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene# 122053) ...
-
No products found
because this supplier's products are not listed.
Bojan F. Hörnich, et al.,
bioRxiv - Microbiology 2021
Quote:
... by amplifying the TurboGFP open reading frame from the vector pGIPZ (Thermo Scientific Open Biosystems) using the primers TurboGFP for Gal4Luc before ATG ov (GGTACTGTTGGTAAAATGGAGAGCGACGAGAGC ...
-
No products found
because this supplier's products are not listed.
Auke B.C. Otten, et al.,
bioRxiv - Cell Biology 2021
Quote:
... open reading frames were PCR-amplified using CloneAmp HiFi PCR Premix (Clontech), gel-purified using the Nucleospin® Gel and PCR Clean-Up kit (Macherey-Nagel) ...
-
No products found
because this supplier's products are not listed.
Lucie Zilova, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Adjustment of open reading frame following the splice acceptor was accomplished via Q5 (NEB) mutagenesis by inserting a single or two nucleotides (+1 or +2 ...
-
No products found
because this supplier's products are not listed.
Kentaro Ikegami, et al.,
bioRxiv - Cell Biology 2019
Quote:
Open reading frames of OR genes were subcloned into pCI (Promega) with a Rho tag at the N terminal ...
-
No products found
because this supplier's products are not listed.
Atossa C. Ghorashi, et al.,
bioRxiv - Biochemistry 2023
Quote:
... to amplify the open reading frame (ORF) of each gene (Origene, catalog no ...
-
No products found
because this supplier's products are not listed.
Raphaël Pantier, et al.,
bioRxiv - Biochemistry 2020
Quote:
... TET1 open reading frame was subcloned into pRSFDuet plasmids (Novagen) for exogenous expression of MBP-tagged proteins in E ...
-
No products found
because this supplier's products are not listed.
Eric J Strobel, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Biotin-11-dATP and biotin-11-dGTP were purchased from Perkin Elmer (Waltham, MA). Biotin-11-dCTP and biotin-11-dUTP were purchased from Biotium (Fremont ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Nagashima, et al.,
bioRxiv - Immunology 2022
Quote:
... Biotin-CD8α (53-6.7, Biolegend), Biotin-CD19 (6D5 ...
-
No products found
because this supplier's products are not listed.
Houqing Yu, Roarke A. Kamber, Vladimir Denic,
bioRxiv - Molecular Biology 2021
Quote:
... Full-length open reading frames or truncated forms of the target proteins were inserted into pGADT7 (AD) or pGBKT7 (BD) vectors (Clontech Laboratories) ...
-
No products found
because this supplier's products are not listed.
E. van der Kouwe, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Nuclear run-on (NRO) assays were performed with 2 biotin-11-NTPs (biotin-11-CTP and biotin-11-UTP, Jena Bioscience) as described in D ...
-
No products found
because this supplier's products are not listed.
Marshall Lukacs, et al.,
bioRxiv - Genetics 2019
Quote:
... into the complete open reading frame of the canonical 307 amino acid human NMNAT2 isoform cloned into expression vector pCMV-Tag2 (Stratagene). The expressed NMNAT2 proteins have a Flag tag and short linker sequence (17 amino acids ...
-
No products found
because this supplier's products are not listed.
Sima Taheri, et al.,
bioRxiv - Genomics 2022
Quote:
... with digoxigenin 11-dUTP or biotin 11-dUTP (Roche) using the linearised clone pTa71 (from Triticum aestivum ...
-
No products found
because this supplier's products are not listed.
Anastassia Mikhailova, et al.,
bioRxiv - Microbiology 2020
Quote:
... Intracellular staining for AAC-11 was performed with anti-AAC-11 antibody (Abcam, ab65836) 1/200 dilution for 1hr at RT followed by anti-rabbit IgG-A647 secondary antibody (LifeTechnologies ...
-
No products found
because this supplier's products are not listed.
Hyunwoo Kwon, et al.,
bioRxiv - Immunology 2020
Quote:
... and/or CD8 neutralizing antibodies (Clone 53-6.7, BioXCell), followed by 100 μg thereafter on the indicated days ...
-
No products found
because this supplier's products are not listed.
Luciana Lazar-Stefanita, et al.,
bioRxiv - Genetics 2023
Quote:
... pombe chromosomes (BioRad, 170-3633) to maximize size resolution of the largest chromosomes ...
-
No products found
because this supplier's products are not listed.
Máté Kiss, et al.,
bioRxiv - Immunology 2020
Quote:
... or biotin-labeled antibodies (Jackson Immunoresearch) were applied ...
-
No products found
because this supplier's products are not listed.
Fabrice Legeai, et al.,
bioRxiv - Genomics 2019
Quote:
... and the anti-biotin antibody with FITC (Vector laboratories) (dilution 1/200 ...
-
No products found
because this supplier's products are not listed.
Zimu Deng, et al.,
bioRxiv - Immunology 2020
Quote:
Mouse antibody against ERGIC-53 was from Santa Cruz Biotechnology.
-
No products found
because this supplier's products are not listed.
Anatolie Marta, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
Mitotic chromosomes were examined by Olympus BX53 epifluorescence microscope and Axio Imager Z2 microscope equipped with CCD camera (DP30W Olympus ...
-
No products found
because this supplier's products are not listed.
Aleksey Chudnovskiy, et al.,
bioRxiv - Immunology 2022
Quote:
... an anti-biotin–PE antibody (Miltenyi Biotec) was exclusively used as described 26 ...
-
No products found
because this supplier's products are not listed.
Darko Bosnakovski, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... A codon optimized version of the ENSOANG00000047618 open reading frame was synthesized by Biomatik. cDNAs for DUXA and DUXB were synthesized by Integrated DNA Technologies ...
-
No products found
because this supplier's products are not listed.
Leah S. VandenBosch, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Mice having EGFP knocked-into the Sox2 open reading frame were obtained from Jackson Laboratories (Stock: 017592) and bred to generate P2 litters(Arnold et al ...
-
No products found
because this supplier's products are not listed.
Julia L. de Amorim, et al.,
bioRxiv - Biochemistry 2023
Quote:
The Exosc3 open reading frame encoding the mouse EXOSC3 protein was cloned into pGEX-6P-2 plasmid (GE Healthcare Life Sciences (now Cytiva)) to create an N-terminally glutathione-S-transferase (GST ...
-
No products found
because this supplier's products are not listed.
Eric J Strobel, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Biotin-11-dCTP and biotin-11-dUTP were purchased from Biotium (Fremont, CA).
-
No products found
because this supplier's products are not listed.
Srijan Jhingan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5’ and 3’ untranslated regions and open reading frames) for the paralogs were made using the CLC Main workbench 7 (QIAGEN® Aarhus A/S, Aarhus C, Denmark). Sequence alignments were generated for the genomic DNA ...
-
No products found
because this supplier's products are not listed.
Madhura R. Pandkar, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The readings were measured using a microplate reader (BioTek Eon, 11-120-611) set at 37°C and an optical density of 450nm ...
-
No products found
because this supplier's products are not listed.
Baylea Davenport, et al.,
bioRxiv - Physiology 2022
Quote:
... an anti-biotin antibody (Cell Signaling) was also applied to visualize the biotinylated protein ladder ...
-
No products found
because this supplier's products are not listed.
Wen-An Wang, et al.,
bioRxiv - Physiology 2022
Quote:
... the mouse anti gamma-tubulin antibody from ThermoFisher (MA1-850) and the rabbit anti ERGIC-53 antibody from MERCK (E1031). The SARS-CoV-2 E-protein wild-type and N15A/V25F cDNA sequences were ordered as synthetic plasmids with flanking EcoRI and XhoI cut sites from GeneArt and cloned into pcDNA using EcoRI and XhoI enzymatic digestion ...
-
No products found
because this supplier's products are not listed.
Mathieu Schulz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Chromosomes were imaged with an upright widefield microscope (Leica) and around 100 cells were analyzed per cell line on Fiji for counting.
-
No products found
because this supplier's products are not listed.
Jennifer Blaze, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and a stereotactic frame (Stoelting). Stereotactic coordinates for mPFC injection were as follows ...
-
No products found
because this supplier's products are not listed.
Xiaoxiao Zhang, et al.,
bioRxiv - Biochemistry 2024
Quote:
Complete open reading frame of murine pro-CtsK (GE Dharmacon) were cloned into pUNO1 (Invivogen) expression vector using AgeI and NheI restriction sites ...
-
No products found
because this supplier's products are not listed.
David Baidoe-Ansah, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2017) (Suppl. Table 1) targeting the open reading frame into AAV U6 GFP (Cell Biolabs Inc., San Diego, CA, USA) using BamH1 (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Raiha Tahir, et al.,
bioRxiv - Cancer Biology 2021
Quote:
Anti-biotin antibody (Bethyl Laboratories, #150-109A), streptavidin-HRP (Abcam ...
-
No products found
because this supplier's products are not listed.
Rajdeep S. Khangura, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The gas-exchange measurements were taken on the third leaf on plants at the V3 stage between 11 AM and 1 PM using LICOR LI-6400XT open photosynthesis system (LI-COR Inc., Lincoln, NE, USA). Four B73-NILs × Oy1-N1989/oy1:B73 ...
-
No products found
because this supplier's products are not listed.
Seungmae Seo, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5ng/ml IL-11 (Peprotech, 200-11), and 25ng/ml IGF-1 (Peprotech ...
-
No products found
because this supplier's products are not listed.
Abhinay Ramaprasad, et al.,
bioRxiv - Genomics 2020
Quote:
... haematocrit readings (Beckman Coulter Counter) and body weight readings were taken daily for 20 days or until host mortality to monitor parasitaemia ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... biotin-conjugated anti-PlGF2 antibody (BAF465, R&D Systems) was added followed by a Streptavidin-HRP (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Charlotte Rimbault, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Images were acquired by image streaming for up to 4000 frames (sptPALM) or up to 20000 frames (PALM) at frame rate of 50 Hz using Metamorph software (Molecular Devices, USA), and analysis were performed with a homemade software developed under MetaMorph and kindly provided by J.B ...
-
No products found
because this supplier's products are not listed.
Yun Hwa Choi, et al.,
bioRxiv - Immunology 2023
Quote:
... and open-field (LE802S from Panlab Harvard Apparatus). Rotarod tests were conducted for 3 minutes on a rotating cylinder with constant speed at 8 rpm.
-
No products found
because this supplier's products are not listed.
Ik-Jung Kim, et al.,
bioRxiv - Microbiology 2022
Quote:
... The GFP-Flag was constructed by replacing the ORF8-Strep of ORF8-Strep with the GFP-Flag open reading frame sequence (Sino Biological). ORF8-Flag I9P was constructed by replacing ATT with CCT at I9 of ORF8-Flag ...
-
No products found
because this supplier's products are not listed.
Emma V. Waters, et al.,
bioRxiv - Genomics 2022
Quote:
... Overnight cultures were used to inoculate 200 µL isosensitest broth to an OD600 of ∼0.1 before OD readings were taken every 10 min over 11 hrs with a Fluostar Optima Microplate Reader (BMG Labtech).
-
No products found
because this supplier's products are not listed.
Gali Maor, Ronald R. Dubreuil, Mel B. Feany,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated secondary antibodies (1:200, SouthernBiotech) and avidin-biotin-peroxidase complex (Vectastain Elite ...
-
No products found
because this supplier's products are not listed.
Luisa Berná, et al.,
bioRxiv - Genomics 2021
Quote:
... (53) using Nextera XT (Illumina). Paired-end reads were sequenced on the MiSeq platform (2 × 150 cycles).
-
No products found
because this supplier's products are not listed.
Zhengrong Zhang, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 11) anti-CD19 antibody (#NBP2-25196SS, Novus Biologicals, Littleton, CO, USA) to identify B lymphocytes ...
-
No products found
because this supplier's products are not listed.
Christopher M. Driskill, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Recording electrodes (WPI; 4–6 MΩ open tip resistance) were filled with an internal solution consisting of (in mM) ...
-
No products found
because this supplier's products are not listed.
Ruoyu Chai, et al.,
bioRxiv - Animal Behavior and Cognition 2021
Quote:
... The camera (Nikon, 25 frames s-1) is set up on the side of the observation area ...
-
No products found
because this supplier's products are not listed.
Cesar L Cuevas-Velazquez, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Fluorescence readings were acquired using a Safire fluorimeter (Tecan) for donor fluorophore (mCerulean3 excitation 433 nm ...
-
No products found
because this supplier's products are not listed.
Thomas Blackwell, et al.,
bioRxiv - Biophysics 2020
Quote:
... Biotin-labeled actin (2 µM) was prepared using 10% biotin actin (Cytoskeleton) in KMg25 buffer ...