-
No products found
because this supplier's products are not listed.
Joshua T. Rose, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... cholera toxin to 100ng/mL (Thomas Scientific, Swedesboro, NJ), hydrocortisone to 500ng/mL (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
The optimal receptor-binding domain (OBD) (100, 100) of Tetanus Toxin (Heavy Chain/B Subunit) was synthesized by GENEWIZ (incorporating flanking 5’ Hindlll and 3’ Nco1 restriction sites ...
-
No products found
because this supplier's products are not listed.
Lise Hunault, et al.,
bioRxiv - Microbiology 2023
Quote:
... anti-toxin B biotinylated antibody (BBI solutions, Madison, WI) followed by high sensitivity Streptavidin-HRP conjugate (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Yi-Wen Chang, et al.,
bioRxiv - Systems Biology 2020
Quote:
... ATP synthase β subunit (GeneTex), HA-tag (BioLegend ...
-
No products found
because this supplier's products are not listed.
Biana Bernshtein, et al.,
bioRxiv - Immunology 2023
Quote:
... Tetanus toxin and Ebola (CEFTA, Mabtech Inc) were used as a control ...
-
No products found
because this supplier's products are not listed.
Tom Lemonnier, et al.,
bioRxiv - Cell Biology 2019
Quote:
... PP6 catalytic subunit (1:500, Bethyl A300-844A) and GST (1:10,000 ...
-
No products found
because this supplier's products are not listed.
Sieglinde De Cae, et al.,
bioRxiv - Microbiology 2023
Quote:
... the SARS-CoV-2 spike S2 subunit (ACROBiosystems, S2NC52H5) or BSA ...
-
No products found
because this supplier's products are not listed.
Anuja R. Bony, et al.,
bioRxiv - Neuroscience 2020
Quote:
... USA) and human GABAB1 and GABAB2 subunits (OriGene Technologies, Inc, Rockville, MD USA) using Lipofectamine 2000 (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Heather R. Keys, Kristin A. Knouse,
bioRxiv - Genomics 2021
Quote:
... monoamine oxidase B (MAO-B) (1:1,000, Novus Biologicals NBP1-87493), lamin B2 (1:1,000 ...
-
No products found
because this supplier's products are not listed.
José Wojnacki, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Y27632 from Calbiochem (Cat Number: 688000) and C3 toxin (Rho Inhibitor I) from Cytoskeleton (Cat Number: CT04).
-
LC Laboratories' Product Number E-5500 - Epothilone B, Free Base (EPO-906, EpoB, Patupilone,...
Cat# E-5500, SKU# E-5500_2mg,
2 mg, $51.00
Ask
Jorge Iván Castillo-Quan, et al.,
bioRxiv - Cell Biology 2022
Quote:
... (LC laboratories: B-1408) which was directly added io the NGM during plate pouring at 200 μM (stock diluted in DMSO at 50 mM) ...
-
No products found
because this supplier's products are not listed.
Wenrui Huang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sudan Black B (EMS 21610) solution at 0.1% m/v in 30% MQ water and 70% ethanol was placed on the sections for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Lewis Timimi, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and those containing V1 or V1VO subunits were combined and concentrated on 100,000 MWCO spin concentrators (Sartorius). The glycerol content in the concentrated samples was reduced by diluting 10-fold with V-ATPase wash buffer and reconcentrating.
-
No products found
because this supplier's products are not listed.
Catherine W. Cai, et al.,
bioRxiv - Immunology 2020
Quote:
... and B6.129S6-Cybbtm1Din/J mice lacking the gp91phox catalytic subunit of NADPH oxidase (gp91phox KO, The Jackson Laboratory) were obtained directly from the vendor or maintained as breeding colonies within the Hoft laboratory ...
-
No products found
because this supplier's products are not listed.
Maxime Penisson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 6 % agarose (LE-8200-B, Euromedex) PBS solution ...
-
No products found
because this supplier's products are not listed.
Diana E. Mitchell, et al.,
bioRxiv - Neuroscience 2022
Quote:
... MultiClamp 700 B amplifiers (Molecular Devices) were used for electrophysiological recordings of L5 pyramidal neurons with a patch electrode (4-7MΩ ...
-
Cat# HY-P1446-1 mg,
1 mg, USD $750.0
Ask
Kruno Vukušić, Iva M. Tolić,
bioRxiv - Cell Biology 2023
Quote:
... Aurora B inhibitor ZM-447439 (MedChemExpress, IC50 value 130 nM ...
-
No products found
because this supplier's products are not listed.
Dawson D. Kerns, et al.,
bioRxiv - Pathology 2023
Quote:
Purified Vip3Aa (25 µg) and Cry1Ac (1 µg) toxins were radiolabeled with 0.5 mCi of NaI125 (Perkin Elmer) using chloramine T ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Rosy P. Cárdenas-Sandoval, et al.,
bioRxiv - Bioengineering 2021
Quote:
Soft cantilevers T R400P B (Olympus, Japan) with a nominal spring constant of 0.09 N/m ...
-
No products found
because this supplier's products are not listed.
Xavier Leray, et al.,
bioRxiv - Biophysics 2021
Quote:
... Magic red Cathepsin-B essay (ImmunoChemistry Technologies).
-
No products found
because this supplier's products are not listed.
Elisa Vilardo, et al.,
bioRxiv - Biochemistry 2023
Quote:
The binding of the subunits of mtRNase P to different mitochondrial pre-tRNAs was measured by bio-layer interferometry on a BLItz instrument (Pall FortéBio). For immobilization on streptavidin-coated sensors pre-tRNAs were 5’- or 3’-end biotinylated ...
-
No products found
because this supplier's products are not listed.
Paul V. Hickner, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
... and Sobral 1S-B and Jacobina-A (3MαH).
-
No products found
because this supplier's products are not listed.
Yixuan Huang, et al.,
bioRxiv - Microbiology 2023
Quote:
... LAMBDA 10-B Smart Shutter from Sutter Instrument, an OkoLab stage incubator ...
-
No products found
because this supplier's products are not listed.
Yunfan Bai, et al.,
bioRxiv - Systems Biology 2023
Quote:
... 10 μL of IS B (Avanti Polar Lipids Inc.) containing 1.0 nmol monoacylglycerol (MG ...
-
No products found
because this supplier's products are not listed.
Toby S. Turney, Vivian Li, Stephen G. Brohawn,
bioRxiv - Neuroscience 2021
Quote:
... 1% n-Dodecyl-b-D-Maltopyranoside (DDM, Anatrace, Maumee, OH), 0.2% Cholesterol Hemisuccinate Tris Salt (CHS ...
-
No products found
because this supplier's products are not listed.
Mark S. Ladinsky, et al.,
bioRxiv - Cell Biology 2020
Quote:
... placed individually into brass planchettes (Type A/B; Ted Pella, Inc.), and rapidly frozen with a HPM-010 High Pressure Freezing machine (BalTec/ABRA) ...
-
No products found
because this supplier's products are not listed.
Rachael Deis, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... and mouse anti-b-Actin antibody (Jackson ImmunoResearch, #111-035-003). Membranes were washed 3x for 10min in 1X TBST and incubated with the secondary antibody ...
-
No products found
because this supplier's products are not listed.
Anna V. Elleman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... beta subunit (Cedarlane, Ontario, Canada)).41 Cells were fed every 2–4 days by changing 50% of the working medium.
-
Recombinant Antigen
Cat# VC-CTXB-1000,
1mg USD $6973.0
Ask
Scott P. Davies, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... subunit 1 (The Native Antigen Company), followed by Alexa Fluor 555-conjugated goat anti-rabbit IgG secondary antibody (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Fernando Ferreira, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... the peptide toxin GsMTx4 (Smartox Biotechnology, 08GSM001) wasdissolved in H2O in a stock of 200 µM and stored at −80 °C ...
-
No products found
because this supplier's products are not listed.
Luting Poh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Total Caspase-1 and Cleaved Caspase-1 (p33 subunit) (Adipogen, AG20B0042), Cleaved Caspase-1 (p20 subunit ...
-
No products found
because this supplier's products are not listed.
Ya-Juan Wang, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or GST-tagged human GABAA receptor β2 subunit protein (GST-β2) (Abnova, catalog #: H00002561-P01) was mixed with 4 μg of recombinant His-tagged human Hsp47 protein (Novus ...
-
No products found
because this supplier's products are not listed.
Romain Durand, et al.,
bioRxiv - Genomics 2023
Quote:
... hygromycin B (BioShop Canada), G418 (BioShop Canada) ...
-
No products found
because this supplier's products are not listed.
Trevor van Eeuwen, et al.,
bioRxiv - Biophysics 2021
Quote:
... tfb6Δ strain containing TAP tags on TFIIH subunits Tfb4 and Ssl2 was grown by fermenter (Eppendorf) in 100 L of YPAD medium to OD 10.0 ...
-
No products found
because this supplier's products are not listed.
Amelia Foss, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 2% amphotericin B (Euroclone) and maintained under hypoxic conditions (1% O2 ...
-
No products found
because this supplier's products are not listed.
Katja R. Kasimatis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... hygromycin B (A.G. Scientific, Inc.) was added to the plates at a final concentration of 250μg/ml ...
-
No products found
because this supplier's products are not listed.
Celia Segui-Perez, et al.,
bioRxiv - Cell Biology 2022
Quote:
... b-actin (Bioss, bs-0061R), MUC13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Patrick J. Madden, et al.,
bioRxiv - Immunology 2022
Quote:
... DOTA-NHS-ester (#B-280, Macrocyclics) was dissolved in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
Madhusoodhanan Suresh Kumar Meena Kumari, et al.,
bioRxiv - Immunology 2024
Quote:
... IFN-I receptor subunit 1 (IFNAR1) blocking antibody (MAR1-5A3) and IgG isotype control antibody (MOPC-21) from BioXCell. S ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
because this supplier's products are not listed.
Jörg Schweiggert, et al.,
bioRxiv - Cell Biology 2021
Quote:
... energy regeneration solution (B-10, Boston Biochem) in assay buffer were carefully pipetted directly on the arrays ...
-
No products found
because this supplier's products are not listed.
D. C. Indurthi, A. Auerbach,
bioRxiv - Biophysics 2021
Quote:
... δ and ε subunits in the ratio 2:1:1:1 (TransIT® 293 transfection reagent; Mirus Bio, Madison, WI). Electrophysiological experiments started ~48 hours post-transfection ...
-
No products found
because this supplier's products are not listed.
Célie Cokelaere, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... coated culture flasks in TEpiCM-b medium (#2561-b) supplemented with TEpiCGS (#2572) and 5 mL penicillin/streptomycin (#0503) (all from Sciencell). All experiments were performed with Mycoplasma-free cells (regularly tested with Venor™ GeM ...
-
No products found
because this supplier's products are not listed.
Mohamad El Shami, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... amphotericin B (250 ng/mL, Gemini Bio-Products 400104), and Plasmocin (2.5 mg/mL ...
-
No products found
because this supplier's products are not listed.
Nadège Gouignard, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... at 100 μg/mL or Magenta-Phos (Biosynth, B-7452). The following probes were used ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Manuel Albanese, et al.,
bioRxiv - Cell Biology 2020
Quote:
Human primary B cells were prepared from adenoidal mononuclear cells by Ficoll Hypaque (PAN Biotech) gradient centrifugation (as described in Albanese et al. ...
-
No products found
because this supplier's products are not listed.
Aurora Alvarez-Buylla, et al.,
bioRxiv - Physiology 2023
Quote:
... we used the Zymo RiboFree Total RNA Library Prep kit (R3003-B, Zymo Research, Irvine, CA) following manufacturer instructions ...