-
No products found
because this supplier's products are not listed.
Aidan McGlinchey, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 3β-Hydroxy-5-cholestene-3-linoleate (ChoE(18:2)) from Larodan, were prepared to the following concentration levels ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Ainelen Piazza, et al.,
bioRxiv - Microbiology 2022
Quote:
The quantification of c-di-GMP levels was performed using the Cyclic-di-GMP Assay Kit from Lucerna (Catalog Number: 200-100). Cultures of the strains were adjusted to OD600 = 0.2 and set up for the assay in 30-µl aliquots along with assay reagents and serially diluted c-di-GMP standards ...
-
No products found
because this supplier's products are not listed.
Benjamin P. Brown, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... L747_A750>P (#E10-12MG, lot G1200-3), and L747_E749 (#E10-12LG, lot G1344-5) were purchased from SignalChem. The Promega ADP-Glo™ kinase assay kit was used to quantify the amount of ADP produced by each EGFR variant in 1XBFA buffer and in the presence or absence of erlotinib at varying concentrations ...
-
No products found
because this supplier's products are not listed.
Geoffrey A. Smith, et al.,
bioRxiv - Genomics 2021
Quote:
... cells were washed and then treated with 5 µg/ml 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) labeled LDL (Kalen Biomedical) in low-glucose DMEM with 0.5% BSA (MilliporeSigma ...
-
No products found
because this supplier's products are not listed.
Sachiko Koyama, et al.,
bioRxiv - Physiology 2019
Quote:
... culture medium was replaced with low calcium medium (CnT-PR, CELLnTECH; Zen-Bio, Research Triangle Park, NC) and penicillin streptomycin (1140122 ...
-
No products found
because this supplier's products are not listed.
Neil D. Sargison, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... and E198L or E198A SNPs were determined by separate pyrosequencing primers using the PyroMark ID system using the allele quantification (AQ) mode of the PSQ 96 single nucleotide position software (Biotage, Sweden). Previously ...
-
No products found
because this supplier's products are not listed.
Rufeng Xu, et al.,
bioRxiv - Pathology 2021
Quote:
... [3-3H] glucose (3 μCi; Moravek, California, USA) was administered at t = −90 min ...
-
No products found
because this supplier's products are not listed.
Le Xu, et al.,
bioRxiv - Cell Biology 2024
Quote:
... Primary antibodies with final concentrations used for immunofluorescence staining: rabbit anti-SCGB1A1 polyclonal antibody [5 mg/ml] (WRAB-3950, Seven Hills Bioreagents), mouse anti-FOXJ1 monoclonal antibody [8 mg/ml] (14-9965-80 ...
-
No products found
because this supplier's products are not listed.
Virginia Savy, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 3-week-old females were primed by intraperitoneal injection of 5 IU of equine chorionic gonadotropin (Lee Biosolutions, Maryland Heights, MO) followed 46–48 h later by 5 IU human chorionic gonadotropin (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Carlos Flores, et al.,
bioRxiv - Microbiology 2023
Quote:
... media in both apical and basal chambers was replaced by calcium-rich (1.2 mM) differentiation barrier medium (CnT-Prime-3D medium, CELLnTEC), designated day 0 ...
-
No products found
because this supplier's products are not listed.
Patrice Delaney, et al.,
bioRxiv - Genetics 2023
Quote:
... Fisher Scientific; 1327-53-3), As(V) (Arsenic V Speciation Standard, Fisher Scientfic; 7732-18-5, AsB (Arsenobetaine Standard Solution, LGC Standards; NIST-3033), DMA (Dimethylarsinic Acid Standard Solution ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Jan D. Beck, et al.,
bioRxiv - Immunology 2023
Quote:
... and 60 mg/kg 5-fluorouracil (5-FU) (Medac) in 0.9% NaCl (Braun ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2021
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-3 and # 101-5) in RPMI 1640 1% FBS ...
-
No products found
because this supplier's products are not listed.
Maria E. Candela, et al.,
bioRxiv - Immunology 2021
Quote:
Treatments with HBD3 peptide(s) was after 15-30 minutes 5 μg/ml of human β-Defensin-3 (hBD3) (Peptide Institute Inc., PeptaNova GmbH #4382-s), or 5 μg/ml of Linear Defensin (Almac Sciences Scotland Ltd ...
-
No products found
because this supplier's products are not listed.
Jérôme Cattin-Ortolá, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5% FBS (RMBIO), and 1X Pen/Strep (GIBCO ...
-
No products found
because this supplier's products are not listed.
Nguyen-Vi Mohamed, et al.,
bioRxiv - Neuroscience 2021
Quote:
... hMOs were incubated in a shaker (100 rpm, 37°C) for 3 days with primary antibodies: rabbit anti-tyrosine hydroxylase (TH, 1:500, Pel-Freez Biologicals, AR, USA) and chicken anti-microtubule associated protein 2 (MAP2 ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Alena Aliashkevich, et al.,
bioRxiv - Microbiology 2020
Quote:
3 gr of seeds (e.g. Medicago sativa) were mashed and soaked in 10 mL of water overnight followed by centrifugation at 5,000 rpm to remove the particulate fraction ...
-
No products found
because this supplier's products are not listed.
Jessica T. Stieglitz, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... 8: (S)-2-Amino-6-((2-(3-methyl-3H-diazirin-3-yl)ethoxy)carbonylamino)hexanoic acid (PhK, Iris Biotech GmBH); and 9 ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Jolet Y. Mimpen, et al.,
bioRxiv - Immunology 2021
Quote:
... Primers (Supplementary Table 3) were purchased from Primerdesign Ltd (Primerdesign Ltd ...
-
All viral vectors
Cat# KM30500,
ViroMag 100µL + ViroMag RL 100µL + AdenoMag 100µL, USD $235.75/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Karl Alex Hedin, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... for preventing bacterial growth and 1 g/L 5-Fluoroorotic Acid (5-FOA; Nordic BioSite) for preventing other yeast species from growing.
-
No products found
because this supplier's products are not listed.
Chiaki Imanaka, et al.,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum albumin (BAC62, Equitech-Bio, Kerrville, TX), and 0.02% polyoxyethylene sorbitan monolaurate (166–21115 ...
-
No products found
because this supplier's products are not listed.
Sonia Ponzo, et al.,
bioRxiv - Neuroscience 2019
Quote:
... We performed separate 3 (GVS: LGVS vs. RGVS vs. Sham) × 2 (Velocity ...
-
No products found
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... and KAT 5 (KAT5-1350H; Creative Biomart) proteins following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ping Lv, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The primary antibodies included TMOD4 antibody (CUSABIO, China, CSB-PA609953ESR2HU); HuR antibody (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Kelly L. Buchanan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or the sweet taste receptor inhibitor (T1R2/3) gurmarin (Peptides International) were dissolved into 1M sucrose ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lane, et al.,
bioRxiv - Bioengineering 2024
Quote:
... thrombopoetin (TPO) and Flt-3 ligand (both from CellGenix, Freiburg, Germany). An overnight pre-treatment incubation was carried out after thaw at 37 °C ...
-
No products found
because this supplier's products are not listed.
Marie-France Dorion, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% fetal bovine serum (FBS; Wisent Bioproducts), which was previously shown to promote high phagocytic activity and MerTK expression.35 Fetal hMGL were cultured in DMEM (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals) at a dilution of 100 folds ...
-
No products found
because this supplier's products are not listed.
Júlia Vallvé-Juanico, et al.,
bioRxiv - Immunology 2022
Quote:
... the antibodies were resuspended with Antibody Stabilizer (Boca Scientific, Dedham, MA, USA) at a concentration of 0.2 mg/ml and stored at 4°C ...
-
No products found
because this supplier's products are not listed.
Alyssa Huff, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 1.5 CaCl2, 30 D-glucose) equilibrated with carbogen (95% O2, 5% CO2) by a peristaltic pump (Dynamax RP-1, Rainin Instrument Co; Emeryville CA, USA). As previously published (figure 6a (Huff et al. ...
-
No products found
because this supplier's products are not listed.
Andrew T. Phillips, et al.,
bioRxiv - Cell Biology 2022
Quote:
... or β5-integrin (Assay Biotechnology; San Franscisco, CA; catalogue #: F-5) primary antibody for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
Cat# F101,
USD $80.00/EA
Ask
Bocheng Yin, et al.,
bioRxiv - Biochemistry 2019
Quote:
... The stock solution of 0.5 M biotin-dPEG®3-benzophenone (biotin-BP, 10267, Quanta BioDesign) in anhydrous DMSO (89139-666 ...
-
No products found
because this supplier's products are not listed.
Michael Bowe, et al.,
bioRxiv - Immunology 2023
Quote:
... and secondary IgA and IgM antibodies (Brookwood Biomedical).
-
Rabbit polyclonal antibody to PDE1C
Cat# CQA5421,
200 ul USD $350.0, 100 ul USD $220.0, 50 ul USD $150.0
Ask
Rafał Zdrzałek, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Respective primary HRP-conjugated antibodies (α-FLAG: Cohesion Biosciences, CPA9020 ...
-
No products found
because this supplier's products are not listed.
,
bioRxiv - Microbiology 2019
Quote:
... brain and lungs were collected and placed in labeled 5 ml tubes (CELLTREAT, Pepperell, MA) containing 2 ml of HBSS with no dye on ice ...
-
No products found
because this supplier's products are not listed.
Cory Schwarz, et al.,
bioRxiv - Microbiology 2022
Quote:
... plus 5% defibrinated horse blood in fastidious anaerobe agar (FAA) (Neogen, Lansing, MI, United States). When growth was visible on the plates ...
-
No products found
because this supplier's products are not listed.
Roie Cohen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Samples were then incubated overnight at 4°C in the appropriate primary antibody diluted in antibody diluent buffer (GBI labs cat: E09-300). Following 3 washes in PBS ...
-
No products found
because this supplier's products are not listed.
Scott C. Bolton, et al.,
bioRxiv - Biochemistry 2023
Quote:
... the culture was supplemented with 10 mL (5%) Boost Production Additive (Expression Systems LLC, Davis, CA) where indicated ...
-
No products found
because this supplier's products are not listed.
Nana Naetar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... cells were stained with an anti-mEos2 antibody (Badrilla, Leeds, UK) following the standard IF protocol.
-
No products found
because this supplier's products are not listed.
Chiara E. Geyer, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 concentration was determined using antibody pairs from U-CyTech Biosciences (Human IL-6 ELISA ...