-
No products found
because this supplier's products are not listed.
J.J. Patten, et al.,
bioRxiv - Microbiology 2022
Quote:
... DNA was amplified using T7 promoter-containing forward primer 5’-TAATACGACTCACTATAGGGTAAAGGCCAACAACAACAAG-3’ and reverse primer 5’-GAGTCAGCACTGCTCATGGATTG-3’ from GENEWIZ (MA, USA). After electrophoresis and gel extraction by Monarch DNA Gel Extraction Kit (NEB) ...
-
No products found
because this supplier's products are not listed.
Charlotte F. Chao, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... 0.5 g calcium chloride dihydrate (CCL302.1, BioShop Canada), 0.5 g magnesium sulfate heptahydrate (MAG511.1 ...
-
No products found
because this supplier's products are not listed.
Tali Kiperman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Antibodies used were diluted in 5% milk (Labscientific CN: M0841). Primary and secondary antibodies with dilutions used are described in Suppl ...
-
No products found
because this supplier's products are not listed.
Judith Olzhausen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... the assay depends on ATP-dependent conversion of D-[1-14C] pantothenate (55 mCi/mMol; Biotrend, Cologne, Germany) to phosphopantothenate and its binding to DEAE cellulose ion exchange filter disks which were subsequently analyzed by scintillation counting (6 assays for each PanK variant) ...
-
No products found
because this supplier's products are not listed.
F. Phil Brooks III, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a stack of one 5 mm and two 3 mm round cover glass (Thomas Scientific, 1217N66), pre-glued by optical glue (Norland 61) ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... which were diluted 1:100 in triplicate into 5 mL fresh CHG media containing either 100 μM of the corresponding substrate (either LCA [Sigma] or 3-oxoLCA [Steraloids]). Cultures were grown for 48 hours at 37 °C ...
-
No products found
because this supplier's products are not listed.
Julien Hazemann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 0.03 M each of magnesium chloride and calcium chloride (condition A3 of Morpheus I screen, Molecular Dimensions Ltd).
-
No products found
because this supplier's products are not listed.
Renée M. van der Sluis, et al.,
bioRxiv - Immunology 2021
Quote:
... were added to Calu-3 cells in 50 μL PBS and antibodies neutralizing IFNα (mouse anti-human IFN alpha antibody, clone MMHA-2, PBL Assay Science Cat#21100-2) or isotype control (Purified mouse IgG1 ...
-
No products found
because this supplier's products are not listed.
Gopinath Chattopadhyay, et al.,
bioRxiv - Biophysics 2022
Quote:
... The eluted fractions were pooled and dialysed thrice using a 3-5 kDa (MWCO) dialysis membrane (40mm flat width) (Spectrum Labs) against 1X PBS ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
MU Wagenhäuser, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... specific antibodies were used (Emfret Analytics, GPIb/CD42b ...
-
No products found
because this supplier's products are not listed.
Yaniv Shlosberg,
bioRxiv - Bioengineering 2023
Quote:
Cyclic voltammetry was done using palmsens4 potentiostat with screen-printed electrodes (Basi), with a graphite working electrode (1mm in diameter) ...
-
No products found
because this supplier's products are not listed.
Elisabet Bjånes, et al.,
bioRxiv - Microbiology 2024
Quote:
... Strains were grown in liquid THB (Hardy Diagnostics (or Oxoid THB for Fig. 1C, right panel) without aeration at 37°C ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Patricia K. Dranchak, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The library was arrayed as DMSO stock solutions in Echo-qualified 384-well cyclic olefin copolymer plates (Labcyte, Inc.) formatted for qHTS ...
-
No products found
because this supplier's products are not listed.
Valeria Taliani, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... resuspended with 5 μg of MATR3 (Supplementary File 5) or IgG antibodies (Immunoreagents Inc.) and incubated for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Rupa Banerjee, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 6-9 PE-units) and 3-5 mg Silane-PEG-Biotin (Nanocs, 3400 Da) in a solution of 50 mL toluene at 55 °C ...
-
No products found
because this supplier's products are not listed.
Vivian K. Rojas, et al.,
bioRxiv - Microbiology 2024
Quote:
... The chromogenic molecule X-Phos (5-bromo-4-chloro-3-indolyl phosphate, Chem-Impex) was added to agar plates with the purpose of detecting S ...
-
No products found
because this supplier's products are not listed.
Philip Jean-Richard-dit-Bressel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The center of the right side-wall included a recess (5 x 3 x 15 cm) that housed a magazine dish (3 cm diameter) into which 45mg grain pellets (Bio-Serv, NJ, USA) were delivered ...
-
No products found
because this supplier's products are not listed.
Lars Emil Larsen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using a 5 µL Hamilton Neuros Syringe (33 gauge, point style 3, Hamilton company, USA) and a Quintessential Stereotaxic Injection System (Stoelting ...
-
This product is a mouse antibody that recognizes human PDE1C. It can be used in the following...
Cat# MOB-2868z,
Inquiry
Ask
Alberto Iannuzzo, et al.,
bioRxiv - Immunology 2024
Quote:
... Nucleotide coding sequences of myc-tagged CDC42 WT and variants cloned into the pLenti-EF1a-IRES-EGFP (Creative Biolabs) were provided by the CIGEx facility (CEA ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
PDE1C Antibody is a Rabbit Polyclonal against PDE1C.
Cat# abx340057-100UG,
100 µg USD $391.5
Ask
Mark Møiniche, et al.,
bioRxiv - Bioengineering 2024
Quote:
... followed by incubation with a primary rabbit anti-Mal d 3 polyclonal antibody (Catalog #abx300086, Abbexa) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Thanh Ngoc Nguyen, et al.,
bioRxiv - Cell Biology 2023
Quote:
... aqueous uranyl acetate (5 min) and Reynolds lead citrate (3 min) before routine imaging on a JEM-1400PLUS TEM (JEOL). For quantification ...
-
WB, IHC, IF,ELISA
Cat# A5439, SKU# A5439-20ul,
20ul, $47.00
Ask
Kristina A.M. Arendt, et al.,
bioRxiv - Cancer Biology 2020
Quote:
In vitro cell proliferation was determined using WST-8 [water soluble tetrazolium-8 or 2-(4-iodophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-teterazolium] assay (Bimake; Munich, Germany). For this ...
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and laminaripentaose β-1-3-(Glc)5 at a concentration of 1.5 mg·mL−1 were used as standards (Megazyme, Bray, Ireland). To visualize the glucan fragments ...
-
No products found
because this supplier's products are not listed.
Amber Gonda, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Samples were lysed and incubated for 5 minutes in Trizol and then 1-bromo-3-chloropropane (BCP) (Molecular Research Center, Inc. Cincinnati, OH) was added to separate the RNA from the remaining material ...
-
No products found
because this supplier's products are not listed.
Ada Nowosad, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Lysates (500 µg for HEK293 or 2 mg for U251N) were incubated with 3 µg of indicated antibodies and 12 µl protein-A sepharose beads (IPA300, Repligen) (co-IP ...
-
No products found
because this supplier's products are not listed.
Evgeniia N. Bykonia, et al.,
bioRxiv - Immunology 2024
Quote:
... Plates were washed 3 times and incubated with 100 μL HRP-conjugated anti-mouse IgG secondary antibody (L20/01; HyTest; 1:25000) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Kishor Dnyaneshwar Ingole, et al.,
bioRxiv - Plant Biology 2020
Quote:
... The membrane was blocked with 5% non-fat skim milk and western blots performed with indicated primary antibodies [anti-SNC1 (Abiocode), anti-PR1 or anti-PR2 (Agrisera) ...
-
No products found
because this supplier's products are not listed.
Vikas Arige, et al.,
bioRxiv - Physiology 2022
Quote:
... The IP3R1 antibody (#ARC154, Antibody Research Corporation) was used at 1:1000 dilution ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
VP O’Brien, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5% defibrinated horse blood (Hemostat Labs), 10 mg/ml vancomycin (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Ian C. Miller, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5% human AB serum (Valley Biomedical #HP1022), 10 mM N-acetyl L-Cysteine (Sigma #A9165) ...
-
No products found
because this supplier's products are not listed.
Charles Bayly-Jones, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 5 μL of diluted C9-depleted serum (Complement Tech; diluted 1 in 5 with 1×DGHB; 2.5% (w/v) D-glucose ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Julie Firmin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Embryos are placed in pre-equilibrated (at least 4 h at 37°C, 5% O2, 5% CO2) CSCM-C medium (Irvine Scientific) covered with mineral oil (Irvine Scientific ...
-
Cat# AG060,
USD $79.0/5.0ml
Ask
Fujun Hou, et al.,
bioRxiv - Microbiology 2021
Quote:
... ICP27 antibody (Virusys, 1113), 1:5000 ...
-
No products found
because this supplier's products are not listed.
Hannah A. Pizzato, et al.,
bioRxiv - Immunology 2023
Quote:
... or C5 antibody (Quidel) for 30min at 4°C ...
-
No products found
because this supplier's products are not listed.
Djem U. Kissiov, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... In all cases medium contained 5% FCS (Omega Scientific), 0.2 mg/mL glutamine (Sigma) ...
-
No products found
because this supplier's products are not listed.
Hannah I. Ghasemi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... iPSCs were then treated with 3 ml pre-warmed Accutase (Innovative Cell Technologies) and the vessel was then incubated at 37ºC for 5 min ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
Hoyun Kwak, et al.,
bioRxiv - Genetics 2020
Quote:
... The purified antibodies were conjugated with HRP or Alexa 488/Cy3 using an antibody labeling kit (Expedeon, United Kingdom) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Sushant Bhat, et al.,
bioRxiv - Microbiology 2021
Quote:
... (ID Vet) and Influenza A Antibody ELISA (IDEXX) were performed according to manufacturers’ instructions.
-
No products found
because this supplier's products are not listed.
Ruikang Liu, et al.,
bioRxiv - Microbiology 2021
Quote:
... the wells were washed 3 times with 250 μl of PBS + 0.05% Tween 20 (PBS-T, Accurate Chemical) and plates were blocked with 200 μl PBS-T + 5% Nonfat Dry Milk for 2 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...
-
No products found
because this supplier's products are not listed.
Ria Göttert, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies were applied in the following concentrations: mouse anti-CD45 (EXBIO) 1:100 ...