-
No products found
because this supplier's products are not listed.
P Chaudhary, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 3’-cyclic nucleotide 3’- phosphodiesterase (CNP, Millipore MAB326) and proteolipid protein (PLP ...
-
No products found
because this supplier's products are not listed.
Luisa Klein, et al.,
bioRxiv - Neuroscience 2021
Quote:
... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
No products found
because this supplier's products are not listed.
Camila de Britto Pará de Aragão, et al.,
bioRxiv - Neuroscience 2020
Quote:
... calcium-calmodulin kinase II (CaMKII, mouse, 1:2000, Abcam, catalog ab22609), clathrin heavy chain (rabbit ...
-
No products found
because this supplier's products are not listed.
Ana C. Sias, et al.,
bioRxiv - Neuroscience 2021
Quote:
... expressing the genetically encoded calcium indicator GCaMP6f under control of the calcium/calmodulin-dependent protein kinase (CaMKII) promoter (pENN.AAV5.CAMKII.GCaMP6f.WPRE.SV40, Addgene, Watertown, MA) to drive expression preferentially in principal neurons ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Ca2+/calmodulin-dependent protein kinase II (CaMKII, New England Biolabs).
-
No products found
because this supplier's products are not listed.
Katarzyna Zyla-Jackson, et al.,
bioRxiv - Immunology 2023
Quote:
... we incubated sequential de-paraffinized sections with anti-2’,3’-cyclic-nucleotide 3’-phosphodiesterase (CNPase) (mouse CNPase: 1:200 dilution; Biolegend, Inc.), anti-CD3 (rabbit ...
-
No products found
because this supplier's products are not listed.
Nicolas Vabret, et al.,
bioRxiv - Immunology 2019
Quote:
... RNAs were then purified and treated with Terminator™ 5’-Phosphate-Dependent Exonuclease (processive 5’ to 3’ riboexonuclease that specifically digests RNA with 5’-monophosphate ends, Lucigen) for 90 min at 30°C or mock-treated ...
-
No products found
because this supplier's products are not listed.
Mikael G. Pezet, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 0.1 mM 8-Bromoadenosine 3′,5′-cyclic monophosphate sodium salt (Tocris) and 0.1 mM 3-Isobutyl-1-methylxanthine (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Aurore Fleurie, et al.,
bioRxiv - Microbiology 2019
Quote:
... Calmodulin-Sepharose (Stratagene) purification was performed as described (47) ...
-
No products found
because this supplier's products are not listed.
Upasana Saha, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The eluate thus obtained was incubated with equilibrated 200ul Calmodulin beads (Calmodulin SepharoseTM 4B from GE Healthcare) in Calmodulin Binding Buffer (10mM Tris-HCl pH=7.5,150mM NaCl ...
-
No products found
because this supplier's products are not listed.
Kaiwei Liu, et al.,
bioRxiv - Plant Biology 2022
Quote:
... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
No products found
because this supplier's products are not listed.
Tai L. Ng, et al.,
bioRxiv - Systems Biology 2021
Quote:
... 2’,3’-cyclic GMP-AMP (cGAMP) (Invivogen #tlrl-nacga23-5) at a concentration of 1 mg/mL (final concentration in the well 100 ug/mL ...
-
No products found
because this supplier's products are not listed.
Manuel Tavares, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 5’ cyclic mono-phosphate (8-Br-cAMP, Merck B5386) and 1 μM medroxyprogesterone acetate (MPA ...
-
No products found
because this supplier's products are not listed.
Lisa B. Earnest-Noble, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
No products found
because this supplier's products are not listed.
Raquel Guillamat-Prats, et al.,
bioRxiv - Immunology 2021
Quote:
... Calcium 5 Assay Kit (Molecular devices) for 1 h at 37° C ...
-
No products found
because this supplier's products are not listed.
Carolina Montenegro-Venegas, et al.,
bioRxiv - Neuroscience 2021
Quote:
PDE4 activity was assessed using a cyclic nucleotide phosphodiesterase assay kit (#BML-AK800-0001, Enzo Life Sciences) according to the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Bryan C Jensen, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 0.25 µg/ml or rabbit antibody against calmodulin binding peptide Calmodulin Binding Peptide (GenScript) at 0.1 µg/ml ...
-
No products found
because this supplier's products are not listed.
Erin J Stephenson, et al.,
bioRxiv - Physiology 2020
Quote:
... Antibodies used include: SREBP-1c (#557036, BD Pharmingen), FAS (#3180 Cell Signaling Technology) ...
-
No products found
because this supplier's products are not listed.
Yoshimi Nakagawa, et al.,
bioRxiv - Physiology 2020
Quote:
... mCherry-tagged human SREBP-1c was inserted into pmCherry (mCherry-SREBP-1c) (Clontech), and HA-tagged hamster SCAP ...
-
No products found
because this supplier's products are not listed.
A.G. Newman, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using DIG labelled nucleotides (Roche). Following DNA digestion and RNA purification ...
-
No products found
because this supplier's products are not listed.
Ying Liu, Mingming Zhai,
bioRxiv - Bioengineering 2020
Quote:
... SREBP-1c antibody was purchased from Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Pil Jung Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and rabbit monoclonal anti-calmodulin binding protein (Upstate Cell Signaling Solutions ...
-
No products found
because this supplier's products are not listed.
Jana Hucklenbroich, et al.,
bioRxiv - Plant Biology 2021
Quote:
... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
No products found
because this supplier's products are not listed.
Monika Witzenberger, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 0.2 U phosphodiesterase I (VWR), and 2 U alkaline phosphatase (QuickCIP ...
-
No products found
because this supplier's products are not listed.
T. Georgescu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Prlr-iCre mice were crossed with Cre-dependent fluorescent calcium indicator GCaMP6f [B6.Cg-Gt(ROSA)26Sortm95.1(CAG-GCaMP6f)Hze] mice from Jackson Labs to generate mice that express GCaMP6f specifically in Prlr-expressing neurones.
-
No products found
because this supplier's products are not listed.
Nina Kessler, et al.,
bioRxiv - Immunology 2022
Quote:
... cGAMP was measured in undiluted BALF using the 2’,3’-Cyclic GAMP ELISA Kit (Cayman Chemical) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Bryce J. Carpenter, et al.,
bioRxiv - Genomics 2023
Quote:
... Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q15 in a window of 5 nucleotides and keeping only filtered reads longer than 15 nucleotides (Trimmomatic37: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl mouse genome version mm10 (Ensembl release 101 ...
-
No products found
because this supplier's products are not listed.
Josiah J. Herzog, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Secondary antibodies were conjugated to Cy-3 or Cy-5 (1:500, Jackson ImmunoResearch Laboratories).
-
No products found
because this supplier's products are not listed.
Huanhuan Li, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 2.5 μM capped 16-nucleotide RNAs (5’-m7GpppGAAUGCUAUAAUAGC-3’, Trilink), 2 U μL-1 RNasin (Promega) ...
-
Prepared from the 1 mM sodium pyrophosphate, pH 6.9, alumina gel eluate of Hilmoe, Biochem....
Cat# LS003603,
10 un, $118.00
Ask
Mathieu Schulz, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... snake venom phosphodiesterase (Worthington) and alkaline phosphatase (Fermentas) ...
-
No products found
because this supplier's products are not listed.
Esteban Finol, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5 mM of each triphosphate ribonucleotide (standard nucleotides were purchased from Jena Bioscience GmBH and pseudouridine and N1-methylpseudouridine from BOC sciences) ...
-
No products found
because this supplier's products are not listed.
Alexandra Fletcher-Jones, et al.,
bioRxiv - Neuroscience 2023
Quote:
5’ – GCACTACCAGAGCTAACTCAGATAGTACT – 3’ (Origene)
-
No products found
because this supplier's products are not listed.
Fengwei Zheng, et al.,
bioRxiv - Biochemistry 2022
Quote:
Radioactive nucleotides were from PerkinElmer Life Sciences (Waltham ...
-
No products found
because this supplier's products are not listed.
Richard K. Assoian, Tina Xu, Emilia Roberts,
bioRxiv - Cell Biology 2023
Quote:
... and submerged in 5-ml of calcium-containing Hanks Balanced Salt Solution (HBSS; Corning Life Sciences). This closed system was checked for leaks by pressurizing the vessel to 30-mm Hg using HBSS and ensuring that there was no pressure loss through the system ...
-
No products found
because this supplier's products are not listed.
Mirja Harms, et al.,
bioRxiv - Immunology 2020
Quote:
... CXCR4-dependent calcium signaling was determined by stimulating with 100 ng/ml of mouse SDF-1α (PeproTech). To quantify CXCL12-induced Ca2+ mobilization ...
-
No products found
because this supplier's products are not listed.
Karin Uliczka, et al.,
bioRxiv - Physiology 2024
Quote:
... of six genetically independent donors were grown as monolayers in 100% humidity and 5% CO2 at 37 1C in serum-free defined growth media (BEGM, Lonza). NHBEs (passage 3 ...
-
No products found
because this supplier's products are not listed.
Wei Huang, et al.,
bioRxiv - Genetics 2023
Quote:
... 14-3-3 polyclonal antibody (Proteintech, Cat#14503-1-AP), and beta tubulin antibody (Abways Technology ...
-
No products found
because this supplier's products are not listed.
Sunil Shrestha, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The cells were then incubated with a 5 µg/mL of human HNF-3 beta/FoxA2 antibody (R&D Systems; AF2400) for 1.5 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Joy Zhou, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Rabbit polyclonal anti-hyperpolarization-activated cyclic nucleotide-gated channel 1 (HCN1; 1:350; Synaptic Systems), was used to label basket cell axons and pinceau terminals ...
-
No products found
because this supplier's products are not listed.
Byoung Ju Lee, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Calmodulin inhibitory peptide and calmodulin inhibitory peptide scramble were purchased from Calbiochem (Darmstadt, Germany). All other chemicals were purchased from Sigma (St ...
-
No products found
because this supplier's products are not listed.
Caelan E Radford, et al.,
bioRxiv - Immunology 2023
Quote:
... 1 µL of 10 µM 3’ nucleotide tagging primer (PacBio_3pri_C or PacBio_3pri_G), 20 µL KOD Hot Start Master Mix ...
-
No products found
because this supplier's products are not listed.
Joseph T. Vecchi, et al.,
bioRxiv - Bioengineering 2023
Quote:
The third method to assess the micropattern feature dimensions was confocal microscopy (STELLARIS 8, Leica; Fig. 1c, Supp. Fig. 1c)) ...
-
No products found
because this supplier's products are not listed.
Robert S. Porter, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 300 μM dibutyryl-cyclic AMP (StemCell Technologies), 20 ng/ml BDNF (Peprotech) ...
-
No products found
because this supplier's products are not listed.
Robert J. Sheaff,
bioRxiv - Cell Biology 2020
Quote:
... Light emitted by the ATP dependent luciferase was quantitated using a photoluminometer (BioTek Cytation 5). In most cases samples were run in duplicate or triplicate and the standard deviation calculated ...
-
No products found
because this supplier's products are not listed.
John A. Bryant Jr., et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... and fragment mixes for homology dependent assembly (Figure 5) were cleaned and concentrated with DNA Clean & Concentrator-5 columns (Zymo), and DNA was eluted with 10 μL molecular grade water ...
-
No products found
because this supplier's products are not listed.
Etienne Lelièvre, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... engMutfwd 5’-AGAACAGACGAATCTACAGCCGAA-3’ and engintron2rev 5’-AGCATGTTTTAACAAGACGGCAG-3’ primers and HotGoldStar PCR mix (Eurogentec).
-
No products found
because this supplier's products are not listed.
Haley M. Scott, et al.,
bioRxiv - Immunology 2023
Quote:
... Membranes were washed 3 x 5 min in PBS-Tween20 and incubated with appropriate secondary antibodies (LI-COR) for 1h at RT prior to imaging on a LiCOR Odyssey Fc Dual-Mode Imaging System.
-
No products found
because this supplier's products are not listed.
Jan Homolak, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Slides were washed 3×5 min in PBS and incubated with 1:1000 anti-rabbit biotinylated secondary antibody (BA-1000, Vector Laboratories, USA) in 1% NGS in PBST for 1 h at RT ...
-
No products found
because this supplier's products are not listed.
Anastasiia Stratiievska, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Individual intracellular calcium levels of MEG-01 cells were recorded using an inverted XI81F-3 microscope (Olympus, equipped with a motorized stage (MS-2000 ...
-
No products found
because this supplier's products are not listed.
Kevin J. McNaught, et al.,
bioRxiv - Molecular Biology 2020
Quote:
H3K27me2/3 ChIP using anti-H3K27me2/3 antibody (Active Motif, 39536) was performed as previously described (12 ...