-
No products found
because this supplier's products are not listed.
Doris Krauter, et al.,
bioRxiv - Neuroscience 2021
Quote:
... using a diamond knife (Histo HI 4317, Diatome). Afterwards sections were stained according to Gallyas52 and with Methylene blue/ Azur II for 1 min ...
-
No products found
because this supplier's products are not listed.
Thomas D. Avery, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
NRF2/ARE luciferase reporter HEK293 cells (SL-0042-NP, Signosis, Santa Clara, USA) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Chafen Lu, et al.,
bioRxiv - Microbiology 2019
Quote:
... Secondary antibodies were rabbit polyclonal anti-His (Delta Biolabs), Horseradish peroxidase (HRP)-anti-rabbit and HRP-anti-mouse IgG (GE Healthcare ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Laura Sánchez-Caballero, et al.,
bioRxiv - Cell Biology 2019
Quote:
... HEK293 cells expressing inducible NDUFAF3-GFP were cultured in a Wilco dish (Intracel, Royston, UK), washed with phosphate-buffered saline (PBS) ...
-
No products found
because this supplier's products are not listed.
Aman Y. Husbands, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Membranes were washed three times with PBS-T and incubated with 1:2000 anti-His-tag antibody (Abiocode M0335-1) for 1h with gentle shaking at RT ...
-
No products found
because this supplier's products are not listed.
Xuwen Cao, et al.,
bioRxiv - Genetics 2021
Quote:
... C20:5 n3 (Larodan) and C18:0 ...
-
No products found
because this supplier's products are not listed.
Carlos J Nogueras-Ortiz, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or anti-human tetraspanin CD81 (Ancell Corporation, Bayport, MN) biotinylated antibodies ...
-
No products found
because this supplier's products are not listed.
Takahiro Sanada, et al.,
bioRxiv - Microbiology 2022
Quote:
... AB human serum (Pel-Freez Biologicals, Rogers, AR, USA) was used as control serum.
-
No products found
because this supplier's products are not listed.
Shahrnaz Kemal, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All vectors contain an N-terminal 6x-His-tag, C terminal Strep-Tag II tag, with or without a N or C terminal fluorophore (EGFP, mNeonGreen (Allele Biotech), or mRuby2).
-
No products found
because this supplier's products are not listed.
James L. J. Coleman, et al.,
bioRxiv - Biochemistry 2020
Quote:
... A previously reported (16,54) human GPR37L1 was purchased from Multispan; however ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Sangsoon Park, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or 5 µM CHIR99021 (A133052, Ambeed) for 48 hours under serum-free conditions to stimulate cardiomyocyte hypertrophy or proliferation ...
-
No products found
because this supplier's products are not listed.
Masaya Matsubayashi, et al.,
bioRxiv - Biochemistry 2019
Quote:
The human hepatocellular carcinoma cell HepG2 was purchased from Cellular Engineering Technologies ...
-
No products found
because this supplier's products are not listed.
Kyle E. Landgraf, et al.,
bioRxiv - Cancer Biology 2019
Quote:
Human PBMC stimulation and immune-phenotyping studies were performed by iQ Biosciences. Briefly normal PBMCs from three donors were seeded in 96-well plates at 1×105 cells/well and exposed to a 10-fold dilution series of either U2S3-hFc-mutIL2 or U2S3-hFc-wtIL2 (wild-type IL2 ...
-
No products found
because this supplier's products are not listed.
A. Florentin, et al.,
bioRxiv - Microbiology 2019
Quote:
... beads using 5 mM BS3 crosslinker (CovaChem) and then incubated with the supernatant at 4°C ...
-
No products found
because this supplier's products are not listed.
Erdem D. Tabdanov, et al.,
bioRxiv - Cancer Biology 2020
Quote:
Human CD4+ T cells were plated on a glass-bottom dish (Willco Wells) pre-coated with either ICAM-1 (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Ghulam Destgeer, et al.,
bioRxiv - Bioengineering 2020
Quote:
... particles were incubated with varying concentrations of human recombinant NT-proBNP (HyTest, Finland) for 1 hr with subsequent washing ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Edward B. Irvine, et al.,
bioRxiv - Immunology 2023
Quote:
... or IgM (Life Diagnostics, clone 2C11-1-5) antibody was added at a concentration of 0.65μg/mL and incubated shaking at room temperature (RT ...
-
No products found
because this supplier's products are not listed.
Michael Tellier, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and was sequentially ligated to a 5’-adenylated 3’-adapter (5’-rApp/NNNNGATCGTCGGACTGTAGAACTCTGAAC/3ddC) with the truncated T4 RNA ligase II (Bioo Scientific) and to a 5’ adapter (5’-GUUCAGAGUUCUACAGUCCGACGAUC ...
-
No products found
because this supplier's products are not listed.
Vincent Mouilleau, et al.,
bioRxiv - Developmental Biology 2020
Quote:
Human SA001 embryonic stem cell (ESC) line (male, RRID: CVCL_B347) was obtained from Cellectis and used accordingly to the French current legislation (Agency of Biomedicine ...
-
No products found
because this supplier's products are not listed.
Jaylissa Torres Robles, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Samples were boiled at 95ºC for 5 min and fractionated on 5% SDS-polyacrylamide gels with 25 nM Phos-tag reagent (Nard Institute AAL-107) and 50 μM MnCl2 as reported previously78 or by standard SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Stephen A. Schumacher, et al.,
bioRxiv - Physiology 2021
Quote:
Serum PTH concentrations were measured with a human-specific immunoradiometric assay (Scantibodies Laboratory, Santee, CA, USA) with a working range of 6.5-2328 pg/mL ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Elea Boucard, et al.,
bioRxiv - Bioengineering 2021
Quote:
... FSF and embryonic lung fibroblasts MRC-5 (RD-Biotech, Besançon, France) were expanded in DMEM supplemented with ...
-
No products found
because this supplier's products are not listed.
Andreas I. Andreou, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... 2.5 μM DEX (Acros) or 5 μM β-estradiol (LKT laboratories) were added.
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Hanna G. Budayeva, et al.,
bioRxiv - Biochemistry 2023
Quote:
... peptides were cleaned up using a 5 µl C18 Phytip (Biotage, Inc) and injected for LC-MS/MS acquisition.
-
No products found
because this supplier's products are not listed.
Yunwei Lu, et al.,
bioRxiv - Systems Biology 2024
Quote:
We performed eY1H assays using a human TF yeast array (15) as previously described and as follows using a high-density array ROTOR robot (Singer Instruments). The three-plate human TF yeast array and promoter yeast strains were mated pairwise on permissive media agar plates and incubated at 30°C for 1 day ...
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Markus Hackl, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The NTA modified primer (backward primer, 5’-NTA-SS-C6-TCCAAAGGTGAAGAACTGTTCACC) was purchased from Gene Link, Inc ...
-
No products found
because this supplier's products are not listed.
Ram Sagar, et al.,
bioRxiv - Genetics 2023
Quote:
To acquire a high yield of functional neurons we transduced the generated human iPSCs with Ngn2 and rTTA expressing lentivirus (lentivirus was purchased by Cellomics Technology, Maryland USA). We followed an established protocol for generation of induced neuronal cells in 21 days 17 ...
-
No products found
because this supplier's products are not listed.
Thomas W Jackson, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and 5 μl of Proteinase K (20 mg/ml; Viagen Biotech, Los Angeles, CA; Cat: 501-PK) were added to the biopsy sample ...
-
No products found
because this supplier's products are not listed.
Lauren G. Buss, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Cells were exposed to a single dose of 5 Gy irradiation (X-ray, RS 2000 Small Animal Irradiator, Rad Source). The untreated cells were shielded with >6 mm lead.
-
No products found
because this supplier's products are not listed.
Tanya Puccio, Karina S. Kunka, Todd Kitten,
bioRxiv - Microbiology 2021
Quote:
... Concentrations were determined by comparison with a standard curve created with a 10 μg ml−1 multi-element standard (CMS-5; Inorganic Ventures) diluted in 5% TMG nitric acid ...
-
No products found
because this supplier's products are not listed.
Vera Vysochinskaya, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... or to 5 µL peptide/liposome complexes with siRNA and applied to a freshly cleaved mica (SPI Supplies, West Chester, PA, USA). The mixture was then incubated at room temperature for 1 minute ...
-
No products found
because this supplier's products are not listed.
Alberto Domingo López-Muñoz, et al.,
bioRxiv - Microbiology 2023
Quote:
... alone or in combination with purified recombinant proteins were placed in the lower chamber of a 96-well ChemoTx System plate (Neuro Probe # 101-5) in RPMI 1640 1 % FBS ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Ranmal A. Samarasinghe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Papain was resuspended in 5 ml Hibernate E medium (Brainbits, #HE) containing N2 and B27 supplements (Life Technologies ...
-
No products found
because this supplier's products are not listed.
Dávid Kovács, et al.,
bioRxiv - Cell Biology 2021
Quote:
... completed with 5% foetal bovine serum and 1% ZellShield (Minerva Biolabs). A549 cells were maintained in Dulbecco’s Modified Eeagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Xiaona Chen, et al.,
bioRxiv - Cell Biology 2020
Quote:
... gastrocnemius and quadriceps muscles were injected with CTX (Latoxan; 10−5 M). At the indicated time points (3- and 7-day post injury) ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... followed by 5 days of decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Lingling Yin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and SL/KAR treatment using 5 μM rac-GR24 (Chiralix, Nijmegen, The Netherlands). For ChIP-seq experiments ...
-
No products found
because this supplier's products are not listed.
Maik Müller, et al.,
bioRxiv - Systems Biology 2020
Quote:
... Peptides were C18-purified using 5–60 μg UltraMicroSpin Columns (The Nest Group, cat: SEMSS18V) according to manufacturer’s instructions and subjected for mass spectromic analysis using an Orbitrap Fusion Tribrid mass spectrometer (Thermo Scientific ...
-
No products found
because this supplier's products are not listed.
Hanyuan Shen, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
A431 cells were treated with different injections for 48 hours in 96-well plates and the cell culture supernatant was collected and tested for the level of IL-1β by ELISA using human interleukin-1 beta ELISA kit (Biosensis, CA, USA) according to the kit protocol ...