-
No products found
because this supplier's products are not listed.
Lihua Ye, et al.,
bioRxiv - Physiology 2020
Quote:
... IAAld (m/z 159, Ambeed), IEt (m/z 161 ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Csobán-Szabó, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 0.5 mM biotin-pentylamine substrate (Zedira) and 10 mm DTT and 5 mM Ca2+ at 37 °C for 45 min ...
-
No products found
because this supplier's products are not listed.
Caterina Ivaldo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and specific secondary antibodies (anti rabbit/anti mouse IgG-HRP, Euroclone S.p.A, Italy). The blotting membranes were reprobed with loading control antibodies ...
-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
No products found
because this supplier's products are not listed.
Marion Le Rochais, et al.,
bioRxiv - Immunology 2022
Quote:
... tissues were incubated with a secondary antibody coupled to horseradish peroxidase (Polink-1 HRP for Rabbit & Mouse – GBI Labs Kit / AffiniPure Goat Anti-Rat IgG −112-005-143 ...
-
No products found
because this supplier's products are not listed.
Erminia Donnarumma, et al.,
bioRxiv - Physiology 2021
Quote:
A mouse ELISA kit was used to compare serum levels of cardiac troponin I (cTnI, Life Diagnostics) and cardiac myosin light chain 1 (MLC1 ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Holly Holliday, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Slides were blocked with Mouse on Mouse (MOM) blocking buffer (Vector Biolabs) for 1 hour ...
-
No products found
because this supplier's products are not listed.
Pratiksha I. Thakore, et al.,
bioRxiv - Immunology 2022
Quote:
... Pertussis toxin (100ng/mouse, List Biological Laboratories) was injected intravenously on day 0 and day 2 post immunization ...
-
No products found
because this supplier's products are not listed.
Huasheng Yu, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and secondary antibody (AAT Bioquest iFluroTM Alexa 488 goat antirabbit IgG Cat ...
-
No products found
because this supplier's products are not listed.
Chrysa Koukorava, et al.,
bioRxiv - Cell Biology 2023
Quote:
... including optimized mouse primers (Supplementary Table 1) on a ViiA7 (Thermofisher/ABI). Cycles consisted of an initial incubation at 50° C and 95° C for 2 and 10 minutes respectively ...
-
No products found
because this supplier's products are not listed.
Vaibhav Sidarala, et al.,
bioRxiv - Cell Biology 2022
Quote:
... live mouse islets were exposed to 100 nM Mtphagy dye (Dojindo Molecular Technologies) for 3 hours to assess time-dependent accumulation of mitochondria to acidic organelles by the relative fluorescence intensity of the dye per cell as described 91 ...
-
No products found
because this supplier's products are not listed.
Hongyu Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... Index Kits (Hampton Research, Riverside, CA) were used to screen the crystals ...
-
No products found
because this supplier's products are not listed.
Melissa A. Luse, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
L Miyashita, G Foley, S Semple, J Grigg,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... with supplement kit (PromoCell®, Heidelberg, Germany) with Primocin (InvivoGen ...
-
No products found
because this supplier's products are not listed.
Ju-Chan Park, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Easy-BLUETM RNA isolation kit (iNtRON Biotechnology) was used for total RNA extraction following the supplier’s instructions ...
-
No products found
because this supplier's products are not listed.
Abi S. Ghifari, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and purified using Favorprep PCR Purification Kit (Favorgen) according to manufacturer’s instructions and listed primers (Table S1) ...
-
No products found
because this supplier's products are not listed.
Luise Rauer, et al.,
bioRxiv - Microbiology 2023
Quote:
... with 0.1- and 0.5-mm Zirconia beads provided in the ZymoResearch kit (‘Z’) and 0.1 µm Zirconia Beads (BioSpec, Bartlesville, Oklahoma) used for the Qiagen kit (‘Q’) ...
-
No products found
because this supplier's products are not listed.
Michael I. Barton, et al.,
bioRxiv - Immunology 2023
Quote:
... Biotin ATTO 647 (ATTO-TEC #AD 647-71) was then added at 2 µM for one hour and the excess washed off with PBS 1 % BSA ...
-
No products found
because this supplier's products are not listed.
Cameron Vergato, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... anti-mouse IFNAR-1 antibody or mouse IgG (cat. #MS-GF-ED, Molecular Innovations, Novi, MI) diluted in sterile PBS and injected i.p ...
-
No products found
because this supplier's products are not listed.
Hyungsup Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Mouse polyclonal anti-ANO9 antibody (1:100, AbFrontier, South Korea), monoclonal anti-c-Fos antibody (1:1000 ...
-
No products found
because this supplier's products are not listed.
Fabrizio Clarelli, et al.,
bioRxiv - Biochemistry 2019
Quote:
... and CRP (Mouse α-E. coli CRP, 664304, Nordic Biosite antibodies) were diluted 1:250 ...
-
No products found
because this supplier's products are not listed.
Kevin N. Lin, Albert J. Keung, James M. Tuck,
bioRxiv - Synthetic Biology 2019
Quote:
Oligos were purchased with a 5’ biotin modification (Eton Bioscience). Toehold strands were diluted to 1011 strands and mixed with biotinylated oligos at a ratio of 1:40 in a 50 µL reaction containing 2 mM MgCl2 (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Drishya Kurup, et al.,
bioRxiv - Microbiology 2020
Quote:
The following antibodies were used in this study: Anti-ZIKV-E mouse monoclonal antibody (Biofront Technologies, 1176-56), Pan-Flavivirus-E 4G2 mouse monoclonal antibody produced from hybridoma cell line D1-4G2-4-15 (ATCC ...
-
No products found
because this supplier's products are not listed.
Yi Xue, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The objective lens is mounted on a motorized z- stage (FG-BOBZ-M, Sutter Instrument, U.S.). A custom dichroic mirror (zt473/589/635rpc-UF2 ...
-
No products found
because this supplier's products are not listed.
R Barbieri, et al.,
bioRxiv - Microbiology 2020
Quote:
... the paraffin sections were incubated with anti-glycophorin A antibody JC 159 (Mouse Monoclonal Antibody, ref: Mob 066-05, Diagnostic BioSystems, Nanterre, France) at a 1/500 dilution using a Ventana Benchmark autostainer (Ventana Medical Systems ...
-
No products found
because this supplier's products are not listed.
Fan Liu, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The corresponding secondary antibodies (HRP-conjugated goat anti-rabbit or goat anti-mouse, 1:5000, CoWin Biosciences) were probed for 1 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Jingjing Ling, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 10 ng/mL of biotin-labeled target were loaded on Dip and Read™ Streptavidin (SA) Biosensors (Pall Fortebio) until the reading exceeded 1 nm ...
-
No products found
because this supplier's products are not listed.
Mariana F. Tioni, et al.,
bioRxiv - Immunology 2021
Quote:
The ELISpot assay was performed using a mouse IFNγ/IL-5 Double-Color ELISPOT assay kit (Cell Technology Limited). Murine IFNγ/IL-5 capture solution and 70% ethanol was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Thaís Del Rosario Hernández, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... The cages also contained a transparent red mouse house (Bio-Serv, mouse arch, red) and a transparent 7-sided pill box for food and water (Amazon ...
-
No products found
because this supplier's products are not listed.
Deanna M. Marchionini, et al.,
bioRxiv - Neuroscience 2022
Quote:
... blocked in 10% normal goat serum/ 10% mouse- on-mouse blocking (ScyTek Laborities, No. MTM015)/ TBS ...
-
No products found
because this supplier's products are not listed.
Hui-Chia Yu-Kemp, et al.,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-VASP (ECM Biosciences #VM2771) 1:150 ...
-
No products found
because this supplier's products are not listed.
Stacia M. Nicholson, Francis A.X. Schanne,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
Recombinant mouse TNFSF11 (IBI Scientific, Indiana), also known as RANKL ...
-
No products found
because this supplier's products are not listed.
Asad U. Malik, et al.,
bioRxiv - Biochemistry 2020
Quote:
... mouse monoclonal VPS35 (#SMC-605D, StressMarq Biosciences). Rabbit monoclonal anti-Total Rab35 (clone ID ...
-
No products found
because this supplier's products are not listed.
Yuancheng Lu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Mouse anti-Klf4 (1:1000, ReproCell, 09-0021), Rabbit anti-p-S6 (S240/244 ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Phaedra C. Ghazi, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... The DCC-3116 formulated mouse chow (Research Diets) was formulated with an OpenStandard Diet with 15% Kcal% Fat and 360 mg DCC-3116 ...
-
No products found
because this supplier's products are not listed.
Lauriane Cornuault, et al.,
bioRxiv - Physiology 2022
Quote:
... and mouse anti-total PLN (Badrilla, Cat# A010-14).RYR2 phosphorylation was evaluated by SDS PAGE using rabbit anti-phosphoRYR2 antibodies (Badrilla ...
-
No products found
because this supplier's products are not listed.
Karin Santoni, et al.,
bioRxiv - Immunology 2022
Quote:
... sutured and attached to a MiniVent mouse ventilator (Harvard Apparatus). Mice were ventilated with a tidal volume of 10 μl of compressed air (21% O2 ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Irina Sbornova, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Whole eye blots were probed overnight at 4 °C with 1 of two PDE11A antibodies: the pan-PDE11A antibody PD11-112 (1:1000, rabbit, Fabgennix) or the PDE11A4-specific antibody PDE11A#1-8113A (1:10,000 ...
-
No products found
because this supplier's products are not listed.
M. Derbyshire, et al.,
bioRxiv - Neuroscience 2022
Quote:
RNA was extracted from mouse retinas using RNAzol RT (Molecular Research Center Inc.) and cDNA was generated using GOSCRIPT (Promega ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Donald Iain MacDonald, et al.,
bioRxiv - Neuroscience 2023
Quote:
... we produced a mouse Tacr1 DNA construct by gene synthesis (Epoch Life Science, GS66243-3). Tacr1 was subcloned along with a synthesized human G-protein α-subunit gene Gα15 and GCaMP6s it into the lentiviral plasmid backbone pLV-CMV-PGK-Hyg (Cellomics Technology ...
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... and PACT Premier screening kits (Molecular Dimensions). Crystals were not obtained for the Endo H-treated enzyme ...
-
No products found
because this supplier's products are not listed.
Theresa Froehlich, et al.,
bioRxiv - Cell Biology 2023
Quote:
... the mycoplasma kit Venor GeM Classic (Minerva Biolabs) and Taq polymerase (Minerva Biolabs ...
-
No products found
because this supplier's products are not listed.
Caio A. C. G. Brunharo, et al.,
bioRxiv - Genomics 2023
Quote:
... A Hi-C Plant Kit (Phase Genomics, Seattle, WA) was used to create a proximity ligation library that included four restriction enzymes (DpnII ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Cristóbal Cerda-Troncoso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and the Magic Red® kit (Immunochemistry Technologies, Davis, CA, USA), respectively ...