-
No products found
because this supplier's products are not listed.
Natasha D. Durham, et al.,
bioRxiv - Microbiology 2019
Quote:
... Probes were diluted 1:1 with D12 buffer (Cat# CBP-5436-25; Scienion AG) and printed at the final concentrations indicated above in triplicate spots from a 384-well source plate (Cat# CPG-5502-1 ...
-
No products found
because this supplier's products are not listed.
SS Parker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and 1.0% (wt/vol) DNase (Bioline, 9003-98-9) in calcium- and magnesium-free 1X HBSS (Gibco ...
-
Anti-MERS (D12) is a human monoclonal antibody that targets to the DPP4 interacting region of...
Cat# A3145, SKU# A3145-1mg*5,
1mg*5, $1690.00
Ask
Alexandra Nguyen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Z-VAD-FMK and the HSP70 inhibitor JG-98 were from Selleck Chemicals, Munich ...
-
No products found
because this supplier's products are not listed.
S.M. Hetzer, et al.,
bioRxiv - Neuroscience 2023
Quote:
Fluoro-Jade B (FJ-B; Histo-Chem, Jackson, AR; CAT# 1FJB), a marker for degenerating neurons and axons,(Schmued and Hopkins ...
-
No products found
because this supplier's products are not listed.
Timothy J. Aikin, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Prime 95-B sCMOS camera (Photometrics) and a Multiline laser launch (Cairn Research ...
-
No products found
because this supplier's products are not listed.
Andreia R. Fernandes, et al.,
bioRxiv - Cell Biology 2021
Quote:
actin depolymerizer Latrunculin B (Focus Biomolecules) and actin stabilizer Jasplakinolide (ChemCruz ...
-
No products found
because this supplier's products are not listed.
Sean Froudist-Walsh, et al.,
bioRxiv - Neuroscience 2020
Quote:
... with threshold b (Abbott and Chance 2005).
-
No products found
Evelien Eenjes, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 10 μg/mL PureCol (Advanced Biomatrix; 5005-B) for 2 hrs at 37°C ...
-
No products found
because this supplier's products are not listed.
Nadège Gouignard, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... at 100 μg/mL or Magenta-Phos (Biosynth, B-7452). The following probes were used ...
-
No products found
because this supplier's products are not listed.
Husam Taher, et al.,
bioRxiv - Microbiology 2020
Quote:
... Detection was performed using an anti-mouse polymer HRP conjugated system (GBI Labs; Cat. No. D12-110), and developed with Alexa-fluor594 conjugated tyramide at a 1:500 dilution for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Carolyn J. Decker, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The strand-specificity of Scriptseq libraries is >98% (Epicentre product literature) therefore contigs with < 98% of forward strand reads were considered being derived from dsRNA rather than possible contaminating ssRNA.
-
No products found
because this supplier's products are not listed.
Peng Bao, et al.,
bioRxiv - Microbiology 2021
Quote:
... Pyruvic acid sodium (>98%, CAS number: 113–24–6) was purchased from Amresco, USA ...
-
No products found
because this supplier's products are not listed.
Paula Lagan, et al.,
bioRxiv - Microbiology 2023
Quote:
... Oral fluids were collected using Oral Fluid Collection Kits (IDEXX #98-0002094-00). Undyed cotton ...
-
No products found
because this supplier's products are not listed.
Emily Maguire, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Designated wells were inhibited by pre exposure for 2 hours with 3-a-aminocholestane (20µM, B-0341), LY294002 (10µM, B-0294) or SF1670 (5µM, B-0350) (Echelon Bioscience). Cells were then exposed to ice cold 0.5 M TCA (Trichloroacetic acid T6399 Sigma ...
-
No products found
because this supplier's products are not listed.
Yamini Ravichandran, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Human FGF-b (RayBiotech) was also added to the medium at 10 ng/ml for the first four days of culture ...
-
No products found
because this supplier's products are not listed.
Stefanos Zafeiropoulos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... PH was induced in 98 male Sprague-Dawley rats (5-7 weeks, 150-200g, Charles River) using either the Sugen-Hypoxia-Normoxia (SuHxNx ...
-
No products found
because this supplier's products are not listed.
Luis Vigetti, et al.,
bioRxiv - Cell Biology 2024
Quote:
... biotinylated ligands (b-X): b-PEG-OH (PEG1207.0100, Iris Biotech, 4847 g/mol), b-PEG-NH2 (PEG1046 ...
-
No products found
because this supplier's products are not listed.
Lars P. Lunding, et al.,
bioRxiv - Biochemistry 2021
Quote:
... rabbit polyclonal antibodies against mature SP-B and Pro-SP-B (Seven Hills Bioreagents) were a generous gift from Jeffrey A ...
-
No products found
because this supplier's products are not listed.
Celia Segui-Perez, et al.,
bioRxiv - Cell Biology 2022
Quote:
... b-actin (Bioss, bs-0061R), MUC13 (Abcam ...
-
No products found
because this supplier's products are not listed.
Sonam Gurung, et al.,
bioRxiv - Genetics 2023
Quote:
... respectively (BioSpec B-GA 12S2), 86 mm volume coil ...
-
No products found
because this supplier's products are not listed.
Zachary JW Easton, et al.,
bioRxiv - Developmental Biology 2022
Quote:
BeWo (CCL-98) trophoblast cells were purchased from the American Type Culture Collection (ATCC; Cedarlane Labs, Burlington, Canada). Cells were cultured in F12K media (Gibco ...
-
No products found
because this supplier's products are not listed.
Xiao Du, et al.,
bioRxiv - Genomics 2020
Quote:
... (b) All SVs detected by PacBio CCS Reads and supported by either PacBio CLR or ONT were retained ...
-
No products found
because this supplier's products are not listed.
Jaganathan Subramani, et al.,
bioRxiv - Microbiology 2021
Quote:
... B.1.351 (Beta; Cube Biotech # 28721), P.1 (Gamma ...
-
No products found
because this supplier's products are not listed.
Sandhya Manohar, et al.,
bioRxiv - Cell Biology 2020
Quote:
... anti-Aurora B (Bethyl, A300-431) 1:1000 ...
-
No products found
because this supplier's products are not listed.
Marta Zaninello, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 250 μg/ml Amphotericin B (Promocell), 1 μM cytosine arabinoside (Sigma) ...
-
No products found
because this supplier's products are not listed.
Camile C. Fontelles, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antigen retrieval was performed by immersing the tissue sections at 98°C for 40 minutes in 1X Diva Decloaker (Biocare). Tissue sections were treated with 3% hydrogen peroxide and 10% normal goat serum for 10 minutes and were incubated with the primary antibody ...
-
No products found
because this supplier's products are not listed.
Maria Sendino, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The CRM1 inhibitor Leptomycin B (Apollo Scientific) was used at a final concentration of 30 ng/ml for 3 h.
-
No products found
because this supplier's products are not listed.
Charlotte Repton, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 2 µg/mL Latrunculin B (Cambridge Bioscience), 0.1 mM DTT (Promega ...
-
No products found
because this supplier's products are not listed.
Marvin Reich, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Activity assays for cathepsin B (Abnova, KA0766), cathepsin D (Abnova ...
-
No products found
because this supplier's products are not listed.
Deanna N. Edwards, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Ad-CMV-b-Gal (Vector Biolabs #1080) or Ad-CMV-Null (Vector Biolabs #1300 ...
-
No products found
because this supplier's products are not listed.
An Phu Tran Nguyen, et al.,
bioRxiv - Neuroscience 2019
Quote:
PF-360 was synthesized as described in patent US2014/005183 at >98% purity and formulated into medicated chow at 35 or 175 mg/kg by Research Diets, as previously described (41) ...
-
No products found
because this supplier's products are not listed.
Carl Schulz, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... to 2/98% over 2:50 min:sec on a Luna™ 5 µm C18 50x2.0 mm 100 A column (Phenomenex, Aschaffenburg, Germany). For MS/MS analyses in the positive electrospray ionisation mode on a Varian 1200 TSQ (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Rachid EI Fatimy, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... anti-Lamin B (ABclonal, A16685, 1:1000 dilution); anti-CDC42-iso1 (Millipore ...
-
No products found
because this supplier's products are not listed.
Merel P.M. Damen, et al.,
bioRxiv - Microbiology 2022
Quote:
... Beads were then washed with buffer B and proteins were eluted using buffer B supplemented with 10 mM desthiobiotin (IBA Lifesciences). Samples were taken at each step of the purification and loaded on SDS-PAGE gels to check the efficiency of affinity purification ...
-
No products found
because this supplier's products are not listed.
Tulika Singh, et al.,
bioRxiv - Immunology 2021
Quote:
B-LCLs were expanded in CELLine bioreactor flasks (Wheaton) following the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Monica J. Chau, et al.,
bioRxiv - Neuroscience 2021
Quote:
... B cell lymphoma 6 (BCL-6) (MyBiosource, San Diego, CA), samples were neat ...
-
No products found
because this supplier's products are not listed.
Bing Han, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... TAAGCGGTTCCGCAAGGAGA (CS-HCP001744-LvSG03-1-B, for Human HK2, GeneCopoeia). The shRNA sequences are as follows ...
-
No products found
because this supplier's products are not listed.
Tomoaki Sobajima, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 10 µM Aurora B inhibitor AZD1152 (ApexBio, A4112-APE-10mM), 25-100 nM PP1/PP2A inhibitor calyculin A (TOCRIS ...
-
Chromatographically purified. A solution in 100 mM sodium chloride. Chymotrypsin and trypsin ² 0.02%.
Cat# LS005302,
Bulk, Inquire
Ask
Wener Li, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... cells were incubated with 1 mg/ml collagenase B (Worthington Biochemical) for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Emily Doucette, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Layers of adhesive cement (C&B Metabond) followed by dental cement (Stoelting) were spread over the surgical site to secure the optical fiber implant to the skull ...
-
No products found
because this supplier's products are not listed.
Rebecca A Capel, et al.,
bioRxiv - Physiology 2019
Quote:
Male Dunkin Hartley guinea pigs (350-550g, Envigo or B&K Universal) were housed and maintained in a 12 h light-dark cycle with ad libitum access to standard diet and sterilised water ...
-
No products found
because this supplier's products are not listed.
Ji Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... Sample was combined with Biomix B and BirA (as per Avidity protocol) and incubated at 4°C for 14 hours ...
-
No products found
because this supplier's products are not listed.
Molly Brady, et al.,
bioRxiv - Neuroscience 2021
Quote:
... a NIRF filter set (Semrock ICG-B, IDEX Health & Science LLC Rochester NY) and camera (Prosilica GT1380 ...
-
No products found
because this supplier's products are not listed.
N Vishnu, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... Insulin secretion was measured with a human insulin ELISA (Mercodia A/B, Sweden) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Yiru Long, et al.,
bioRxiv - Immunology 2024
Quote:
... B cells were deleted by intraperitoneal (i.p.) injection of anti-CD20 (BE0356, BioXcell) on day -2 (150 μg/each ...
-
No products found
because this supplier's products are not listed.
Rafael E. Sanchez-Pupo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Granzyme B imaging was performed in an LSM 800 Confocal Microscope (Carl Zeiss) using a Plan-Apochromat LCI Plan-Neofluar 25x (0.8 Imm Korr Water DIC ...
-
No products found
because this supplier's products are not listed.
Anna Höving, et al.,
bioRxiv - Cell Biology 2019
Quote:
... cells were again seeded in gelatin B-coated T-25 cell culture flasks (Sarstedt AG & Co.) in hCSC-medium ...
-
No products found
because this supplier's products are not listed.
Nuri K. Hegelmeyer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Strains containing selectable markers were cultured on medium with 50 µg/mL hygromycin (Hygromycin B Solution, Mirus) or 25 µg/mL kanamycin (GoldBio ...
-
No products found
because this supplier's products are not listed.
Travis B. Kinder, et al.,
bioRxiv - Immunology 2020
Quote:
300 HLA-B HiBit cells/well were plated into white 1536-well plates (Greiner, Monroe, NC, 789173-F) in 5 uL/well of GM using a Multidrop Combi (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Jorge Morales, et al.,
bioRxiv - Microbiology 2021
Quote:
... incubated with a 1:1,000 dilution of mouse anti-GFP [B-2] (SantaCruz Biotechnology) or a rat anti-RFP [5F8] (Chromotek) followed by a 1:5,000 dilution of the horseradish peroxidase-conjugated secondary antibody against mouse IgG (7076 ...