-
No products found
because this supplier's products are not listed.
Amani A. Hariri, et al.,
bioRxiv - Biophysics 2021
Quote:
... Custom imaging chamber components were purchased from Grace Bio-Labs. Coverslips were purchased from Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Yuya Maruyama, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... GTP binding assay was performed using a GTP Gi Binding Assay Kit (Cisbio) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
T. Bhattacharjee, et al.,
bioRxiv - Biophysics 2020
Quote:
... The components to prepare the EZ Rich are purchased from Teknova Inc ...
-
No products found
because this supplier's products are not listed.
Daniel L. Johnson, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 600 µg of WCE was mixed with 2 µg of α-FLAG antibody in a total volume of 400 µL WCE buffer that had been mock treated or treated with 3 µg of K48ub or K63ub linkage specific Tandem Ubiquitin Binding Entities (TUBEs) purchased from LifeSensors. Samples were rotated at 4°C for a minimum of two hours before adding Protein A agarose beads and rotating at 4°C for an additional one hour to capture the immune complexes ...
-
No products found
because this supplier's products are not listed.
Marcel E. Sayre, et al.,
bioRxiv - Neuroscience 2021
Quote:
... neural tissue was left to incubate for 2-3 days in primary antibody solution consisting of 1:250 mouse anti-TH (AB_572268; ImmunoStar; Hudson, WI) in 1% PBST with 1% NGS ...
-
No products found
because this supplier's products are not listed.
Guojun Wu, et al.,
bioRxiv - Microbiology 2022
Quote:
... lipopolysaccharide-binding protein (Hycult Biotech, PA, USA), leptin (P&C ...
-
No products found
because this supplier's products are not listed.
MegAnne Casey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using the primary antibodies rabbit anti-cleaved caspase-3 (Trevigen) and chicken anti-Atp7a (Sigma) ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Hongmei Qiao, et al.,
bioRxiv - Genomics 2020
Quote:
... AFP4/TMAC2 (ABI FIVE BINDING PROTEIN 4, AT3G02140), DOG1 (AT5G45830 ...
-
No products found
because this supplier's products are not listed.
Stanimir S. Ivanov, et al.,
bioRxiv - Microbiology 2021
Quote:
... (2) incubated with rabbit anti-N.g antibody (Fitzgerald Ind.) in the presence (ΔdotA infections ...
-
No products found
because this supplier's products are not listed.
Simon P. Graham, et al.,
bioRxiv - Immunology 2020
Quote:
... a 100 µL of TMB (One Component Horse Radish Peroxidase Microwell Substrate, BioFX, Cambridge Bioscience, Cambridge, UK) was added to each well and the plates were incubated for 7 minutes at RT ...
-
No products found
because this supplier's products are not listed.
Laura E. Burnett, et al.,
bioRxiv - Neuroscience 2024
Quote:
... PAG tissue was dissected using a 2 mm diameter biopsy punch (ID: 2 mm, OD: 3 mm, Fine Science Tools, 18035-02). Each purification was performed independently three times and samples were stored at -80 °C until further processing ...
-
No products found
because this supplier's products are not listed.
Yoshiteru Shimoda, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and emission fluorescence was collected via 3 photomultipliers and filters (PMT 1: 450-500 nm; PMT 2: 515-560 nm; PMT 3: 590-650 nm). iGluSnFR and iGABASnFR imaging was performed by using a spiral line scan at 40-60Hz at 320 × 320 pixel (512 × 512 μm ...
-
No products found
because this supplier's products are not listed.
C.M. Opazo, et al.,
bioRxiv - Cell Biology 2021
Quote:
In vitro polyubiquitination was measured using the protocol and components from the Ubiquitylation Kit (Biomol; Enzo Life Sciences). Some modifications were included in this in vitro system as described by Sato et al. ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Olivier Da Ines, et al.,
bioRxiv - Genetics 2022
Quote:
... 2 mM X-Gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronic acid; Biosynth), dissolved in N,N-dimethylformamide) ...
-
No products found
because this supplier's products are not listed.
Barun Mahata, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Next each of 3 100ul aliquots (∼1/3 of each 24 well) of cells were processed for H3K4me3 antibody (Epicypher, #13-0041), H3K27ac antibody (Epicypher ...
-
No products found
because this supplier's products are not listed.
Wenyi Zhang, Yang Xie, Tianming Yang,
bioRxiv - Neuroscience 2021
Quote:
... We recorded extracellular single-unit activities with tungsten microelectrodes (FHC: 0.3-2 MΩ; AlphaOmega: 0.5-3 MΩ). Each electrode was driven by an independent microdrive (AlphaOmega EPS ...
-
No products found
because this supplier's products are not listed.
Julie G Burel, et al.,
bioRxiv - Immunology 2020
Quote:
... 2 μl of anti-human CD19-PECy7 antibody (clone HIB19, TONBO biosciences), and 3 μl of anti-human TCRab-AF488 antibody (clone IP26 ...
-
No products found
because this supplier's products are not listed.
Alexis Osseni, et al.,
bioRxiv - Physiology 2022
Quote:
... Non-specific binding was blocked with 4% bovine serum albumin (BSA, Euromedex) diluted in 1X PBS supplemented with Tween 0.1% ...
-
No products found
because this supplier's products are not listed.
Eric M. Patrick, et al.,
bioRxiv - Biochemistry 2019
Quote:
... prior to binding of the complex to 1 μM diameter polystyrene beads (Spherotech) functionalized with an anti-digoxigenin antibody (Roche ...
-
No products found
because this supplier's products are not listed.
Ryoji Fukabori, et al.,
bioRxiv - Neuroscience 2020
Quote:
... A&M systems) m above the tip of the recording electrode (tip diameter: 2-3 μm, impedance: 15-20 MΩ, Harvard Apparatus). The pipette was lowered into the LC ...
-
No products found
because this supplier's products are not listed.
Masaya Harada, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 0.3% Triton x-100) before staining with the respective primary antibodies (NAc and LH with αGFP chicken 1:1000, Aves Labs ref GFP-1010 ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
William N. Feist, et al.,
bioRxiv - Bioengineering 2024
Quote:
Cells were harvested 2-3 days post-electroporation and genomic DNA (gDNA) was harvested using QuickExtract DNA extraction solution (Biosearch Technologies, Hoddesdon, UK, cat.: QE09050). To quantify knock-in alleles via ddPCR ...
-
No products found
because this supplier's products are not listed.
Osvaldo Artimagnella, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 2% FBS (Euroclone), 1X Pen/Strept (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Steven Heshusius, et al.,
bioRxiv - Cell Biology 2019
Quote:
... storage components (Sanquin Plasma Products ...
-
Gelatin methacrylate (GelMA) is a gelatin-based bioink that provides mammalian cells with the...
Cat# IK3051020303,
3 mL, USD $310.0
Ask
Priya H. Dedhia, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Components of HyStem-HP kit (Advanced Biomatrix) – thiolated and heparinized hyaluronic acid (HA) ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Binding was detected with HRP-conjugated secondary antibodies and visualized by Brightfield ECL (Thomas Scientific) on the ChemiDoc (BioRad).
-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
Cole Zmurchok, William R. Holmes,
bioRxiv - Biophysics 2021
Quote:
... We show the probability densities of the x-component of the cluster displacements obtained from ABM simulations as a normalized histogram ...
-
No products found
because this supplier's products are not listed.
Sandra Scheiblhofer, et al.,
bioRxiv - Immunology 2021
Quote:
The capacity of sera from immunized mice to inhibit the binding of spike protein to ACE2 was analysed using a SARS-CoV-2 Spike:ACE2 Inhibitor Screening Assay kit (BPS Biosciences, Cat. No. 79931) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Michal H. Kolář, et al.,
bioRxiv - Biophysics 2021
Quote:
The VemP constructs (VemP-1, VemP-2, and VemP-3) were synthesized by Biomatik using solid state synthesis at a 95% purity level ...
-
No products found
because this supplier's products are not listed.
Paula García-Huerta, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Samples were probed with primary antibodies: Ataxin-3 (Aviva Systems Biology; Cat#ARP50507_P050), βIII-tubulin (Abcam ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Vasiliki S Lalioti, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and guinea pig anti-PLIN-2 and PLIN3 antibodies (Progen Biotech. GP46, GP30). The secondary antibodies used were Alexa 488 ...
-
No products found
because this supplier's products are not listed.
Kushal Saha, et al.,
bioRxiv - Cell Biology 2022
Quote:
... targeting the region TGAGCAGCCCCCCAATGTCG of OCLN or AAATAATGGCGGCAGCTACG of ATG7 or CGGGGAGCCCCGTAGAACC region of ERK-1 (MAPK-3) or CGCGGGCAGGTGTTCGACGT region of ERK-2 (MAPK-1) or scrambled sgRNA for control in pCRISPR-LVSG03 (Genecopoeia) was used to generate OCLN-/- ...
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Junghwa Cha, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Me-HA was conjugated via Michael Addition with the integrin-binding RGD peptide Ac-GCGYGRGDSPG-NH2 (Anaspec) at a final concentration in the gel of 0.5 mmol/L ...
-
No products found
because this supplier's products are not listed.
Jennifer Schwarz, et al.,
bioRxiv - Biochemistry 2021
Quote:
... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
No products found
because this supplier's products are not listed.
Barbara Bonomelli, Enzo Martegani, Sonia Colombo,
bioRxiv - Microbiology 2021
Quote:
... Spheroplasts were resuspended in 35 µL of binding buffer and incubated with 2.5 µL of Annexin V (ImmunoTools) and 2 µL of a PI (Fluka ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Janne J. Mäkinen, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 2’dUTP and 2’dCTP were from Bioline Reagents (London ...