-
No products found
because this supplier's products are not listed.
Victoria A. Hassebroek, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Rat anti-RFP (#RMA5F8, Bulldog Bio Inc).
-
No products found
because this supplier's products are not listed.
Yasuhiro Fujiwara, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... rat Isotype IgG2a-APC (clone LTF2) (TONBO Bioscience, #20-4031) were added to single cell suspension with 1:100 dilution ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Irina Bregy, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Alexa Fluor® 488 goat anti-rat IgG (H+L)(Nanoprobes/FluoroNanogold) 1:1000 ...
-
3',3'-Cyclic GAMP ( cGAMP ) ELISA / Assay Kit
Cat# K073-H1,
1.0 ea, USD $465.0
Ask
Abraham Shim, et al.,
bioRxiv - Genetics 2024
Quote:
... 2′3′-cGAMP levels were quantified using the 2′3′-cGAMP ELISA Kit (Arbor Assays #K067-H5) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
Cat# 138356-08-8,
Inquire
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Silvana Guioli, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... rat anti ERα (1:200, Fitzgerald), rabbit anti-DMRT1 (1:1500 ...
-
No products found
because this supplier's products are not listed.
Hsiu-Chuan Lin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... co-cultured with rat cortical astrocytes (Genlantis) on PLO/LMN-coated 8-well or 96-well polymer coverslips (µ-Slide ibiTreat ...
-
No products found
because this supplier's products are not listed.
Jayanth S. Shankara Narayanan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Rat HRP Polymer (Cell IDX, 2AH-100) or anti-Rabbit HRP Polymer (Cell IDX ...
-
No products found
because this supplier's products are not listed.
Hower Lee, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Rat brain slices were purchased fresh-frozen (Zyagen), kept at −80 until use and processed the same way as chicken and mouse sections.
-
No products found
because this supplier's products are not listed.
Katharina Braunger, et al.,
bioRxiv - Immunology 2021
Quote:
... rat and guinea pig serum were from Complement Technology.
-
No products found
because this supplier's products are not listed.
Jeremy Rich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... visualized using the polink anti rat kit (GBI Labs) and the peroxidase/diaminobenzidine Rabbit PowerVision kit (ImmunoVision Technologies) ...
-
No products found
because this supplier's products are not listed.
Natalia Abreu de Oliveira, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... the ELISA kit (Rat-NGAL, BioVendor, research and diagnostic products) was used to analyze the urinary NGAL ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Shogo Soma, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats received 100 nL of Fluoro-Gold (2.5% in H2O, Fluorochrome) and 1,200 nL of mRFP expressing G-deleted rabies viral vector (rHEP5.0-ΔG-mRFP ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alvina I. Khamidullina, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Primers CDKN1B-forv 5’-attagctagcATGTCAAACGTGCGAGTGTCTAA-3’ and CDKN1B-rev 5’-taatggatccTTACGTTTGACGTCTTCTGAGGC-3’ (Evrogen, Moscow, Russia) containing NheI and BamHI restriction sites were used for amplification ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
Haichen Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1.0 U in 0.40 mL normal saline for rats) via Hamilton syringe (Hamilton Company; Reno, NV) advanced into the cortex (depth = 3 mm in mouse ...
-
No products found
because this supplier's products are not listed.
Zeenat A. Shyr, et al.,
bioRxiv - Cell Biology 2021
Quote:
Total insulin and proinsulin content were measured using rat/mouse insulin ELISA kit (Crystal Chem, IL) and proinsulin ELISA kit (Mercodia ...
-
No products found
because this supplier's products are not listed.
Li Zhenyu, Li Tian, Liu Meisui, Ivanovic Tijana,
bioRxiv - Microbiology 2022
Quote:
... sn-(1-oleoyl-2-hydroxy)-glycerol-3-phospho-sn-3′-(1′-oleoyl-2’-hydroxy)-glycerol (ammonium salt) (18:1 BMP (R,R); Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Tiechao Ruan, et al.,
bioRxiv - Genetics 2024
Quote:
... was isolated from fresh spermatozoa from the WT mice (n=3) and the Iqch KO mice (n=3) using the RNAsimple Total RNA Kit (Tiangen Biotech, China, 4992858). A Ribo-Zero™ rRNA Removal Kit (MRZPL1224 ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Biggs, Elizabeth A.D. Hammock,
bioRxiv - Neuroscience 2022
Quote:
... 3% bovine serum and HiLyteFluor Texas Red-conjugated streptavidin (AnaSpec, Inc ...
-
No products found
because this supplier's products are not listed.
Francisco Dominguez, et al.,
bioRxiv - Microbiology 2021
Quote:
... It was cloned into pE-SUMOpro-3 plasmid (LifeSensors Inc.) between Nco I and Xho I restriction sites ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Lijin Zou, et al.,
bioRxiv - Synthetic Biology 2020
Quote:
... The human proteins were assigned to 3 Piggybac vectors (System Biosciences, USA) by Golden Gate Assembly method (11 ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...