-
No products found
because this supplier's products are not listed.
Navid Farhoudi, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 19.1 mg of 3-aminophenylboronic acid (3-APB, Frontier Scientific) was dissolved in 87 µL of dimethyl sulfoxide (Sigma-Aldrich) ...
-
No products found
because this supplier's products are not listed.
Priyanka Nain, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 3-(4-hydroxy-3-methoxyphenyl) propanal was procured from AA Blocks. 3-(4-Hydroxy-3-methoxyphenyl ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Saurabh Srivastava, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
No products found
because this supplier's products are not listed.
Gaurav Gupta, et al.,
bioRxiv - Immunology 2019
Quote:
... 4% mouse serum (ImmunoReagents) and 4% goat serum ...
-
No products found
because this supplier's products are not listed.
Elana M. Meijer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 x 3 dotted patterns were created on the membranes of a 6-well Bioflex culture plate (untreated, Flexcell Int). Videos were captured at day 3 (the first day of straining ...
-
No products found
because this supplier's products are not listed.
William L. Brown, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... washed 3 times with CitrisolvTM (Decon Labs, #1601) or xylene for 5-min/each ...
-
No products found
because this supplier's products are not listed.
Laura Mathä, et al.,
bioRxiv - Immunology 2023
Quote:
... FITC-conjugated anti-mouse anti-mouse T1/ST2 (DJ8) was purchased from MD Biosciences. BV605- conjugated anti-human CD45 (HI30 ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Zhiyi Liu, et al.,
bioRxiv - Immunology 2022
Quote:
... NIH/3T3 SMAD2/3-luciferase reporter cell line (Signosis) was co-cultured with BALF ...
-
No products found
because this supplier's products are not listed.
Yin-Wei Kuo, et al.,
bioRxiv - Biophysics 2022
Quote:
... we used a 3:1 molar ratio of 2 kDa α-methoxy-ω-amino PEG: 3 kDa α-amino-ω-carboxy PEG (Rapp Polymere) in the first functionalization step ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Cell Biology 2019
Quote:
... anti-mouse-HRP antibody (ImmunoVision Technologies) was added and the cells were incubated with the secondary antibody for 2 hrs ...
-
No products found
because this supplier's products are not listed.
Guillaume Poncelet, et al.,
bioRxiv - Evolutionary Biology 2022
Quote:
... mouse-anti-mCherry monoclonal (Antibodies.com, A104343) all diluted 1:500 at 4 °C overnight ...
-
No products found
because this supplier's products are not listed.
Shreyas Shah, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 3-(acrylamido)phenylboronic acid (APBA) was purchased from Boron Molecular. Sodium phosphate buffer (0.2 M ...
-
No products found
because this supplier's products are not listed.
Shoib S. Siddiqui, et al.,
bioRxiv - Immunology 2020
Quote:
... or 3’-sialyllactose-PAA-biotinylated (Glycotech, Catalogue number-01-038), diluted in binding buffer ...
-
No products found
because this supplier's products are not listed.
Shang-Xiang Ye, et al.,
bioRxiv - Biochemistry 2022
Quote:
3-Bromo-1,1,1-trifluoroacetone (BFA) (J&K Scientific, catalog number 312226) were dissolved in DMSO to 5 M concentration as a stock solution ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Jasmina Büchel, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... and anti-O6-me-dG antibody (Squarix, EM 2-3, SQM003.1) were used in addition to Dynabeads™ Protein G for Immunoprecipitation (Invitrogen™ ...
-
No products found
because this supplier's products are not listed.
Suranjana Pal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse anti-RFP (1:200; Allele Biotech, catalog #ABP-MAB-RT008 ...
-
No products found
because this supplier's products are not listed.
Rahul Sharma, Martin W. Hetzer,
bioRxiv - Cell Biology 2022
Quote:
... mouse Nesprin3 (Nordic-MUBio # MUB1317P,1:250); rabbit Emerin D3B9G XP (CST # 30853) ...
-
No products found
because this supplier's products are not listed.
Ceniz Zihni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti–Cdc42-GTP mouse monoclonal (NewEast Biosciences) immunofluorescence 1/50 ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Federica De Leo, et al.,
bioRxiv - Biochemistry 2019
Quote:
... 3 hours before muscle injection with 50 µL of 15 µM cardiotoxin (Latoxan). After 6 hours ...
-
No products found
because this supplier's products are not listed.
Hannah M. Starnes, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... PFOS (CAS 2795-39-3, purity ≥ 98%) was from Matrix Scientific (Columbia, SC), and 1H,1H,2H,2H-perfluorooctanol (6:2 FTOH ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The resin block was trimmed using a 3 mm UltraTrim diamond knife (Diatome, USA) and ultramicrotome (UC6 ...
-
No products found
because this supplier's products are not listed.
Anne R. Shim, et al.,
bioRxiv - Biophysics 2024
Quote:
... with 2 µL of a Chromosome 3 Control probe (Empire Genomics, #CHR03-10-RE). Samples were protected from light from hereon ...
-
No products found
because this supplier's products are not listed.
Maria O. Levitin, et al.,
bioRxiv - Genetics 2022
Quote:
... and RPS6 (NSJ Bioreagents; 1:100, mouse anti-rabbit monoclonal). After incubation with primary antibodies ...
-
Recombinant Mouse monoclonal antibody to Human F13A1, expressed in Chinese Hamster Ovary cells(CHO).
Cat# MOB-0573CT,
Inquiry
Ask
Pankaj Sharma, et al.,
bioRxiv - Immunology 2023
Quote:
... while anti-mouse CD77 (BGR23) was purchased from Creative Biolabs. Anti-mouse IgG-HRP (polyclonal) ...
-
No products found
because this supplier's products are not listed.
Raquel Bartolomé Casado, et al.,
bioRxiv - Immunology 2019
Quote:
... LP and IE (n=3) using the merge and calculation functions of Infinicyt software (Cytognos), as described in detail elsewhere (Pedreira et al. ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... mouse anti-HCV core (clone B2, Anogen MO-I40015B, 1:7,500); mouse anti-JFH-1 NS5A (clone 7B5 ...
-
No products found
because this supplier's products are not listed.
Midori Ohta, et al.,
bioRxiv - Cell Biology 2020
Quote:
... the resin was further washed 3 times with washing buffer and incubated with PreScission protease (Eton Bioscience) in elution buffer (20 mM Tris-Cl pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Yiwei Liu, et al.,
bioRxiv - Microbiology 2023
Quote:
... They were either combined at a 1 : 1 ratio or separately subjected to 3% H2O2 (Spectrum Chemical) and incubated at 37°C with 200rpm shaking for up to 2h ...
-
No products found
because this supplier's products are not listed.
Néstor Sampedro Vallina, et al.,
bioRxiv - Bioengineering 2023
Quote:
... (5Z)-5-[(3,5-Difluoro-4-hydroxyphenyl)methylene]-3,5-dihydro-2-methyl-3-(2,2,2-trifluoroethyl)-4H-imidazol-4-one (DFHBI-1T) was purchased from Lucerna Technologies ...
-
No products found
because this supplier's products are not listed.
Carla Merino, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) was obtained from LGC-Dr Ehrenstorfer (LGC Standards, Barcelona, Spain) and 4-Hydroxy-4-(3-pyridyl)-butyric acid (HPBA ...
-
No products found
because this supplier's products are not listed.
Vipul T. Vachharajani, et al.,
bioRxiv - Biophysics 2023
Quote:
... 3-5 mm wide slits were cut with a razor blade into a piece of Parafilm M (Bemis) and sandwiched between a glass slide (1 mm thick ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Miho Matsuda, Chih-Wen Chu, Sergei Y. Sokol,
bioRxiv - Cell Biology 2021
Quote:
... mouse anti-DYKDDDDK mAb clone 2H8 (Cosmo Bio USA, #KAL- K0602, 1:1000) and mouse anti-GFP mAb clone B2 (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Martin F. Orth, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... monoclonal mouse anti-PD-1 antibody (1:80; 315M-96, MEDAC, Wedel, Germany), and monoclonal mouse anti-Ki-67 antibody (M7240 ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Plasma FGF21 concentrations were measured using an FGF21 mouse/rat ELISA kit (BioVendor) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tumininu S. Faniyan, et al.,
bioRxiv - Physiology 2024
Quote:
... Core body temperature of the mouse was measured using a rectal probe (YSI 4000A Precision Thermometer ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... P7 - P75 mouse brains were coronal sectioned using Compresstome (Precisionary Instruments LLC, NC) to a thickness of 30 - 50 μm.
-
No products found
because this supplier's products are not listed.
Xiao Tian, et al.,
bioRxiv - Bioengineering 2023
Quote:
... and applied to BD LSRFortessa Flow Cytometer system or ACEA NovoCyte benchtop flow cytometer (Acea Biosciences, USA). Flow cytometry data were analyzed using FlowJo.
-
No products found
because this supplier's products are not listed.
X. Zhao, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Then the membranes were blocked for 1hr with 3% (w/v) non-fat dry milk (LabScientific Inc., Highlands, NJ). After washing with phosphate-buffered saline plus 0.1% of Tween-20 (PBST) ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Clara Taffoni, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... cGAMP enzyme-linked immunosorbent assay (ELISA) was performed according to the manufacturer’s protocol using the Cayman Chemical 2′3′-cGAMP ELISA Kit (Bertin Bioreagents).
-
No products found
because this supplier's products are not listed.
Sarah K. Williams Avram, et al.,
bioRxiv - Neuroscience 2019
Quote:
... All cages were maintained on high-density ventilated racks (Super Mouse 750, Lab Products Inc.). Mice were maintained on a 12-h light cycle (lights off at 1500h ...
-
No products found
because this supplier's products are not listed.
Swastik Phulera, et al.,
bioRxiv - Biophysics 2024
Quote:
... The virus titer was determined by gp64-PE mouse anti-baculovirus antibody (Expression Systems, CA) using a Guava benchtop Flow Cytometer (Millipore ...
-
No products found
because this supplier's products are not listed.
Jiaojiao Xu, et al.,
bioRxiv - Physiology 2022
Quote:
Plasma renin activity was measured in 3-month old Olfr558 WT and KO mice with a modified angiotensin I measurement kit (S-1188, Peninsula Laboratories). Plasma was collected from male and female Olfr558 WT and KO mice treated with 0.49% NaCl diet (Cat ...