-
No products found
because this supplier's products are not listed.
Ahmed Seddek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Purified recombinant human TOP1 (TopoGEN) was used as positive control.
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Thi K. Tran-Nguyen,
bioRxiv - Molecular Biology 2021
Quote:
Recombinant human GRP78s purchased from StressMarq Biosciences or produced in the laboratory [30] were used as antigens in ELISA ...
-
No products found
because this supplier's products are not listed.
Yuichi Mitsui, et al.,
bioRxiv - Immunology 2022
Quote:
Human PBMCs were purchased from Precision for Medicine, Inc ...
-
No products found
because this supplier's products are not listed.
Pingdewinde N. Sam, et al.,
bioRxiv - Cell Biology 2020
Quote:
... except that human recombinant Usp2Core (LifeSensors Inc., Malvern, PA) was used ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Watcharachai Meemetta, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Forward primer LCHV-MEP93-qF: 5’-GTACTTCATCGCCTACGGAGC-3’ and reverse primer LCHV-MEP93-qR: 5’-TACGTGTGCTTGAGGAGGTC-3’ were synthesized from Bio Basic, Canada ...
-
No products found
because this supplier's products are not listed.
Linlin You, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... coli TTC-pause at 13 mg/mL was incubated with 3-([3-cholamidopropyl] dimethylammonio)-2-hydroxy-1-propanesulfonate (CHAPSO, 8 mM, final concentration; Hampton Research Inc.) prior to grid preparation ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Carlos A. Sánchez-León, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a polyethylene tubing (3 mm inner diameter; A-M Systems), which acted as the active electrode for tRNS ...
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Clement Gallay, et al.,
bioRxiv - Microbiology 2021
Quote:
... The resin was then washed 3 times in GFP-Trap_A Wash buffer (Chromotek) and GFP-proteins were eluted using SDS sample buffer at 95°C for 10 min and analyzed by immunoblotting.
-
No products found
because this supplier's products are not listed.
Kirit Singh, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Cryopreserved PBMCs from healthy donors and from glioblastoma patients were then thawed into PrimeXV T-cell expansion media (FujiFilm) supplemented with 3% of human platelet lysate (hPL, Compass Biomedical) and pelleted at 300g for 10 min ...
-
No products found
because this supplier's products are not listed.
Surbhi Verma, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human MDMs (hMDMs) were isolated from human PBMCs and separated from healthy human donors’ blood using PolymorphPrep (PROGEN,1895) layering and centrifugation ...
-
No products found
because this supplier's products are not listed.
Tracy J. Berg, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primary human astrocytes (3H Biomedical) were cultured in Astrocyte Medium (3H Biomedical ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Sandrine Huot, et al.,
bioRxiv - Immunology 2020
Quote:
... Human MPO and human Lactoferrin ELISA kits were purchased from Assaypro (St. Charles, MO, USA). MMP-9 Duoset ELISA was obtained from R&D Systems ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Mingu Kang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... peroxiredoxin-3 (LF-PA0255, Abfrontier), phospho-PKA substrates (9624 ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Alicja Przybyszewska-Podstawka, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... TGFβ (human TGFβ1, Biorbyt, Cambridge, United Kingdom), Gibson Assembly® Master Mix (NEB) ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... panBAG-1 (human, rabbit monoclonal, RM356, RevMAb), panBAG-1 (mouse ...
-
No products found
because this supplier's products are not listed.
Ben Niu, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Trypsin-3 (786-254; G-Biosciences), Trypsin-4 (786-254B ...
-
No products found
because this supplier's products are not listed.
Mingqi Zhou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3 U APEX Taq (Genesee Scientific), and molecular-grade H2O to bring the total volume to 35 μl.
-
No products found
because this supplier's products are not listed.
Xindi Li, et al.,
bioRxiv - Neuroscience 2024
Quote:
... chicken anti-human IBA1 (Aves Labs, IBA1-0020), mouse anti-human TMEM119 (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Ava P. Soleimany, et al.,
bioRxiv - Bioengineering 2020
Quote:
Fresh frozen human PCa TMAs (BioChain Institute, Inc.; T6235201) were air dried and fixed in ice-cold acetone for 10 minutes ...
-
No products found
because this supplier's products are not listed.
Astrid Hendriks, et al.,
bioRxiv - Microbiology 2023
Quote:
... Human neutrophils were freshly isolated using Polymorphprep (Alere technologies) per manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Tommy Tong, et al.,
bioRxiv - Immunology 2023
Quote:
... followed by anti-human IgG AP conjugate (Accurate Chemicals) and were developed using SigmaFast BCIP/NBT ...
-
No products found
because this supplier's products are not listed.
Jorge Gomez-Deza, et al.,
bioRxiv - Neuroscience 2023
Quote:
The Human Genome-Wide CRISPRi Dual-sgRNA Library (Cellecta KIDHGW-105K-P ...
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Mehdi Zouiouich, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 5’-AAC CGC AAT CAC ATC CAC GA-3’/5’-CAC CTC TGC CAT GAT CAC CG-3’) and the repair template (synthesized by ProteoGenix). The repair template was composed of two homology arms of 1000 bp flanking a puromycin resistance gene and mClover3 coding sequence separated by a P2A cleavage site ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Nicolò Mangraviti, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... The full cDNA sequence of the lncRNA was then amplified with forward primer: 5’- GTATCATAAGGATCCCTTTCCACTGCTCTGGTGAG-3’ and reverse primer: 5’- GTATCATAAGTCGACCTCACCTAGCTGTCTGTCC-3’ and cloned into pAAV-MCS (Cat#: VPK-410, Cell Biolabs Inc.) using the restriction enzymes BamH I and HindIII sites ...
-
No products found
because this supplier's products are not listed.
Amy L. Kimble, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Frozen mouse and human brain tissues were mechanically homogenized (Next Advance Bullet Blender BB724M with 3.2 mm stainless steel beads using setting 4 for 4min at 4C) ...
-
No products found
because this supplier's products are not listed.
Aya M. Saleh, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 5 mM tris(3-hydroxypropyltriazolylmethyl)amine (THPTA; Click Chemistry Tools), 2 mM copper sulfate ...
-
No products found
because this supplier's products are not listed.
Chao Wang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A goat anti-human AAT polyclonal antibody 80A was purchase from ICL Inc ...
-
No products found
because this supplier's products are not listed.
Jeanette M. Metzger, et al.,
bioRxiv - Neuroscience 2022
Quote:
GFP-expressing human embryonic kidney cells (i.e., GFP-HEK cells, GenTarget Inc.) were used as an RNP delivery cell model ...
-
No products found
because this supplier's products are not listed.
Catherine S. Liou, et al.,
bioRxiv - Microbiology 2024
Quote:
... Human commensal type strains were grown on either Brain Heart Infusion (Teknova) agar plates supplemented with 5 μg/mL hemin and 0.5 μg/mL menadione (BHIS ...
-
No products found
because this supplier's products are not listed.
Rebekka Karlowitz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... mouse anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (5G4cc, HyTest, Turku, Finland), mouse anti-Vinculin (#V9131-100UL ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Jiachen Huang, et al.,
bioRxiv - Immunology 2021
Quote:
... 25 µl of secondary antibody (goat anti-human IgG Fc; Meridian Life Science) at a 1:4,000 dilution in blocking buffer was applied to each well for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Alexis S. Zajicek, et al.,
bioRxiv - Neuroscience 2021
Quote:
... blots were stripped between probes with Membrane Stripping Buffer-3 (Boston BioProducts). Signals were detected using SuperSignal West Femto Maximum Sensitivity Substrate Kit (Pierce ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Anne-Sophie Pépin, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 3 kcal/g) or high-fat diet (n=16; HFD; Research Diets Inc. ...
-
No products found
because this supplier's products are not listed.
Sebastián Cerminati, et al.,
bioRxiv - Bioengineering 2021
Quote:
Fed-batch fermentations were carried out in 3 L (New Brunswick Bio Flo 115, USA) fermenters ...