-
No products found
because this supplier's products are not listed.
Nicla Lorito, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Data were normalized on TBP (TATA-Box Binding Protein) or GAPDH (Thermo Fisher Scientific). The relative quantity was determined using ΔΔCt by the CFX Maestro software (BioRad).
-
No products found
because this supplier's products are not listed.
Victoria Nankivell, et al.,
bioRxiv - Cell Biology 2024
Quote:
... An anti-rabbit antibody against TATA-binding protein (1:1000, ab63766, Abcam) was the nuclear protein loading control ...
-
No products found
because this supplier's products are not listed.
Victoria E. B. Hipolito, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Ha-Tag and Tata-box binding protein (TBP; Cell Signaling Technologies, Danvers, MA), all at 1:1,000 ...
-
No products found
because this supplier's products are not listed.
Justyna Okarmus, et al.,
bioRxiv - Neuroscience 2022
Quote:
... mouse anti-microtubule-associated protein 2a+b (MAP2, Sigma #M1406; 1:2000), rabbit anti-tyrosine hydroxylase (TH ...
-
No products found
because this supplier's products are not listed.
Iqbal Dulloo, et al.,
bioRxiv - Cell Biology 2022
Quote:
... TFIID (Santa Cruz, #sc-273; 1:1000), Histone H3 (Cell Signaling ...
-
No products found
because this supplier's products are not listed.
Sierra S. Marable, Eunah Chung, Joo-Seop Park,
bioRxiv - Developmental Biology 2020
Quote:
... Biotin-LTL (1:500, Vector Labs B-1325), FITC-LTL (1:200 ...
-
No products found
because this supplier's products are not listed.
Joana Enes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako ...
-
No products found
because this supplier's products are not listed.
Thomas Klein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ectodermal paired box 6 and SRY-box transcription factor 2 (PAX6/SOX2, Biolegend, San Diego, CA, USA / R&D Systems, Minneapolis, MN, USA), and forkhead box protein A2 (FOXA2 ...
-
No products found
because this supplier's products are not listed.
Thomas Klein, et al.,
bioRxiv - Neuroscience 2023
Quote:
... ectodermal paired box 6 and SRY-box transcription factor 2 (PAX6/SOX2, Biolegend, San Diego ...
-
No products found
because this supplier's products are not listed.
Jian Wang, et al.,
bioRxiv - Neuroscience 2019
Quote:
... the primary neurons coverslips were incubated with the primary antibodies: microtubule-associated protein 2B (MAP2B; 1:200; BD Transduction Laboratories ...
-
No products found
because this supplier's products are not listed.
Scott P. Souza, et al.,
bioRxiv - Immunology 2021
Quote:
High-affinity protein binding microplates (Corning) were coated overnight goat anti-mouse IgM (1mg/ml ...
-
No products found
because this supplier's products are not listed.
Laura de las Heras-García, Olatz Pampliega,
bioRxiv - Neuroscience 2022
Quote:
... Primary antibodies included: ADP ribosylation factor factor-like protein 13 B (Arl13b) (#17711-1-AP, Proteintech), Cathepsin D (#ab75852 ...
-
No products found
because this supplier's products are not listed.
Silvia Oldani, et al.,
bioRxiv - Neuroscience 2020
Quote:
... chicken anti-microtubule-associated protein 2 (MAP2; 1:2000; Chemicon/Merck), and guinea pig anti-vesicular glutamate transporter 1 (VGLUT1 ...
-
No products found
because this supplier's products are not listed.
David O. Dias, et al.,
bioRxiv - Neuroscience 2020
Quote:
... or biotin-conjugated secondary antibodies (1:500, Jackson Immunoresearch). Biotinylated secondary antibodies were revealed with fluorophore-conjugated streptavidin (1:500 ...
-
No products found
because this supplier's products are not listed.
Takehisa Noguchi, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
No products found
because this supplier's products are not listed.
Deepanshu Soota, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the cells were co-transfected with 250ng of 3X ERE with TATA-box luciferase plasmid (Addgene 11354), a gift from Donald McDonnell ...
-
No products found
because this supplier's products are not listed.
Giulia Gaudenzi, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... mRNA expression levels were normalized to the housekeeping human TATA-binding protein (TBP) mRNA (RT2 qPCR Primer Assays, Qiagen) in the GAL4 assay and to the human housekeeping hypoxanthine guanine phosphoribosyltransferase (HPRT ...
-
No products found
because this supplier's products are not listed.
Theodor Marsoner, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
No products found
because this supplier's products are not listed.
Vanessa M. Doulames, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rho-associated protein kinase inhibitor (3 uM; 1293823; PeproTech) was added to the media for 1 day post replating.
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... Factor H protein was purchased from Biorad and the mouse monoclonal IgG1 Factor H Antibody (OX24 ...
-
No products found
because this supplier's products are not listed.
Silvio Schmidt, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the S100 calcium-binding protein B (S100B; rabbit, Synaptic system), and BrdU (mice ...
-
No products found
because this supplier's products are not listed.
Yu Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
No products found
because this supplier's products are not listed.
Umberto Aiello, et al.,
bioRxiv - Genomics 2022
Quote:
... Antibody-associated DNA:RNA hybrids were then captured on protein G Sepharose beads (GE Healthcare), washed and purified according to standard ChIP procedures ...
-
No products found
because this supplier's products are not listed.
Mario Cocco, et al.,
bioRxiv - Immunology 2019
Quote:
... negatively selected B cell fractions with CD23 Biotin and anti-Biotin Microbeads (Miltenyi Biotec)
-
No products found
because this supplier's products are not listed.
Paweł Kozielewicz, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... Protein-low binding tubes (Eppendorf) were used to make serial dilutions of BODIPY-cyclopamine.
-
No products found
because this supplier's products are not listed.
Benjamin Liffner, et al.,
bioRxiv - Microbiology 2020
Quote:
... Primary antibodies (anti-HA biotin conjugate 1:1000 (Roche), mouse anti-RAP148 1:500 ...
-
No products found
because this supplier's products are not listed.
Yunlong Cao, et al.,
bioRxiv - Immunology 2022
Quote:
... and the mixture of ACE2-biotin (Sino Biological, 10108-H27B-B) and serially diluted competitor antibodies was added followed by 30min incubation at RT ...
-
No products found
because this supplier's products are not listed.
Jami M. Gurley, et al.,
bioRxiv - Cell Biology 2020
Quote:
... rabbit polyclonal anti-TRAF3 (TNF Receptor-Associated Factor 3; 1:500; Novus Biologicals, #NBP-88639), and rabbit polyclonal anti-Gαt (Transducin ...
-
No products found
because this supplier's products are not listed.
Kaito Nagashima, et al.,
bioRxiv - Immunology 2021
Quote:
... AviTagged Y2 COBRA HA proteins containing the Y98F mutation to reduce sialic acid binding were biotinylated using the BirA biotin-protein ligase in the BirA500 kit (Avidity) and complexed to streptavidin-fluorophores SA-PE (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Binhan Hao, Wenjie Zhou, Steven M. Theg,
bioRxiv - Biochemistry 2022
Quote:
... PVDF membranes were cut and immunoblotted with α-TatA and α-TatB antibodies respectively followed by HRP-conjugated α-rabbit antibody (GenScript). Proteins were visualized using ProSignal Pico ECL Western Blotting detection kit (Genesee Scientific).
-
No products found
because this supplier's products are not listed.
Rana Lebdy, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibodies against the following proteins were used: Biotin (Bethyl A150-109 and Jackson Immunoresearch 200-002-211) ...
-
No products found
because this supplier's products are not listed.
Kevin R. Bewley, et al.,
bioRxiv - Pathology 2020
Quote:
... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ...
-
No products found
because this supplier's products are not listed.
Sadhana Sharma, et al.,
bioRxiv - Neuroscience 2024
Quote:
... nuclear factor kappa B (NF-κB; 1:1000, ABclonal), NLR Family Pyrin Domain Containing 3 (NLRP3 ...
-
No products found
because this supplier's products are not listed.
Sandra D. Chanez-Paredes, et al.,
bioRxiv - Cell Biology 2023
Quote:
Actin binding and polymerization were assessed using the actin binding protein kit (Cytoskeleton, BK013). Actin pellet gel bands were quantified by densitometry using FIJI.
-
No products found
because this supplier's products are not listed.
Matheus P. Viana, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were re-plated in mTeSR1 medium supplemented with 1% penicillin-streptomycin (Thermo Fischer Scientific) and 10 mM Rho-associated protein kinase (ROCK) inhibitor (Stemolecule Y-27632, STEMCELL Technologies) for 24 hr ...
-
No products found
because this supplier's products are not listed.
Xiuqing Han, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... tumor necrosis factor α (TNF-α) and TATA box binding protein (TBP) were determined by real☐time PCR (ABI 7900 Prism, Applied Biosystems, US). Sequences used to amplify a fragment of IL-6 were FP ...
-
No products found
because this supplier's products are not listed.
Anna C. Fagre, et al.,
bioRxiv - Microbiology 2020
Quote:
... factor-VIII and ionized calcium binding adaptor molecule (IBA-1) (Leica Biosystems) or negative control slides primary antibody was replaced by a rabbit non-specific IgG isotype negative control antibody for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Gali Maor, Ronald R. Dubreuil, Mel B. Feany,
bioRxiv - Neuroscience 2023
Quote:
... biotin-conjugated secondary antibodies (1:200, SouthernBiotech) and avidin-biotin-peroxidase complex (Vectastain Elite ...
-
No products found
because this supplier's products are not listed.
Mark R. MacRae, et al.,
bioRxiv - Biophysics 2022
Quote:
... the purified and concentrated protein was incubated with 1:3 protein to biotin ratio of 1mM NHS-PEG4-Biotin (VWR #PI21362) for 1 hr at room temperature ...
-
No products found
because this supplier's products are not listed.
Christopher D Pascoe, et al.,
bioRxiv - Cell Biology 2020
Quote:
... or blockers of receptors associated with OxPC activity including platelet activating factor receptor (WEB-2086, Tocris 2339), prostaglandin EP2 receptor (PF-04418948 ...
-
No products found
because this supplier's products are not listed.
Jeremy R. Egbert, et al.,
bioRxiv - Cell Biology 2019
Quote:
... antibody binding was detected using fluorescent secondary antibodies (LI-COR Biosciences ...
-
No products found
because this supplier's products are not listed.
M. T. Gyparaki, et al.,
bioRxiv - Cell Biology 2020
Quote:
... recombinant binding protein (gt-250, Chromotek). The secondary antibodies we used were AffiniPure goat anti-mouse IgG (H+L ...
-
No products found
because this supplier's products are not listed.
Himani Sharma, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Biotinylated β-galactosidase (B-βG) and Biotin Alkaline Phosphatase Conjugated (B-ALP) were purchased from Rockland Immunochemicals (PA ...
-
No products found
because this supplier's products are not listed.
Alexandra Veloso, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... amphotericin B (50 ng/ml) epidermal growth factor (10 ng/ml) (Lonza) and 10% Fetal Bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Diana van den Heuvel, et al.,
bioRxiv - Cell Biology 2020
Quote:
... The incorporated EdU was visualized by click-it chemistry-mediated binding of Biotin (Azide-PEG3-Biotin Conjugate; Jena Biosciences) using the protocol and reagents from the Invitrogen Click-iT EdU Cell Proliferation Kit for Imaging (Invitrogen) ...
-
No products found
because this supplier's products are not listed.
Marcelo N. Costa, et al.,
bioRxiv - Neuroscience 2024
Quote:
... and 50 µM Rho-associated protein kinase inhibitor (ROCKi; Calbiochem, USA). This media was changed every other day for 6 days ...
-
No products found
because this supplier's products are not listed.
Mie Suzuki-Okutani, et al.,
bioRxiv - Microbiology 2024
Quote:
Half-well protein high-binding 96-well plates (Greiner) were coated with recombinant SARS-CoV-2 (D614G ...
-
No products found
because this supplier's products are not listed.
Jing-Yi Jeng, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The primary antibodies used were rabbit anti-MAO B (1:200, GeneTex), goat anti-GFP (1:500 ...
-
No products found
because this supplier's products are not listed.
Celina Tretter, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... development was performed with an IFN-γ- detection antibody (7-B6-1-biotin, Mabtech) and Streptavidin-HRP (Mabtech) ...
-
No products found
because this supplier's products are not listed.
Ethan A. Older, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 1 ng/mL LPS-EB Biotin (Invivogen), and 0.1 ...