1 - 50 of 523
suppliers found for
Arg8 Vasopressin AVP ELISA Kit 5 Plate
» view 10000+ matched products-
Arbor Assays Sponsored
Arg8-Vasopressin (AVP) ELISA / assay KitCat# K049-H5, 1.0 ea, USD $1585.0 Ask
-
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in Parasitologia doi: 10.3390/parasitologia1010001Quote: ... Plates were coated with 5 μg/ml TciALDO onto ELISA plates (Maxisorp, Thermofisher Scientific) overnight at 4 °C ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Physiological Reports doi: 10.14814/phy2.14636Quote: ... Serum vasopressin levels were measured using an Arg8-Vasopressin ELISA Kit (Enzo Life Sciences,). All assay kits were used according to manufacturer specifications. -
Corning
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2020Quote: Enhanced ELISA plates (Corning) were coated with diluted anti-IFNγ antibodies (2 μg/mL ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2017Quote: ... AVP (AB1565, 1:4000, Millipore), β-Tubulin (CW0098M ... -
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Systems Biology 2021Quote: Pre-coated ELISA plates were purchased from R&D Systems and performed according to manufacturer instructions ... -
Greiner
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019, published in Cell Reports doi: 10.1016/j.celrep.2019.08.050Quote: ... ELISA plates (Greiner) were coated with 5μg/mL anti-CD3/28 with the final volume of 100μL at 4°C for overnight ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018Quote: ... ATTR-D38A fibrils were immobilized on anti-TTR pre-coated well plates (Prealbumin ELISA kit, Abcam) as follows ... -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Genome Medicine doi: 10.1186/s13073-018-0589-3Quote: Mouse IL-5 ELISA (BD Biosciences, 555236) -
Biotek
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2018, published in eLife doi: 10.7554/elife.42628Quote: ... concentrations measured using commercially available ELISA kits and an EL800 plate reader (BioTeK). Mice were housed in individual metabolic cages for 72 hours and urine collected for the final 24 hours ... -
BioLegend
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... IL1β ELISA kit (BioLegend) was used to measure IL1β secreted into the supernatants ... -
PerkinElmer
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... high protein binding ELISA plates (PerkinElmer) were coated overnight at 4°C with rabbit anti-human IgG (Jackson Laboratories ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019, published in Angiogenesis doi: 10.1007/s10456-019-09703-yQuote: ... the BrdU incorporation ELISA kit (Ref. 11647229; Roche) was used following manufacturer’s instructions ... -
Zymo Research
No products found because this supplier's products are not listed.bioRxiv - Genetics 2019Quote: ... Genomic DNA was used for global (5-mC DNA ELISA Kit -Zymo Research) and specific (satellite I region – BS-PCR ... -
Qiagen
No products found because this supplier's products are not listed.Cited in Programmed genome editing of the omega-1 ribonuclease 1 of the blood fluke, Schistosoma mansonibioRxiv - Molecular Biology 2018, published in eLife doi: 10.7554/elife.41337Quote: ... which were provided in the ELISA kit (Qiagen). Three biological replicates were undertaken. -
Alpco Diagnostics
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... frozen plasma was thawed on ice and 5 uL/sample loaded in duplicate wells onto a 96 well plate in Mouse Ultrasensitive Insulin ELISA kit from ALPCO® ... -
Cayman Chemical
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020, published in Scientific Reports doi: 10.1038/s41598-020-67844-3Quote: Oxytocin and vasopressin were obtained from Cayman Chemical. All working concentration of drugs were dissolved in DPBS and added manually to the HEK 293T cells at the indicated concentrations and time points. -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2021Quote: ... Next morning plates were washed with an ELISA plate washer (ImmunoWash 1575, BioRad) using 0.25 mL wash solution/well (DPBS ... -
Mercodia
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2020Quote: ... Leptin and insulin were assessed by ELISAs (Leptin Mouse ELISA kit, ab100718, Abcam; Mouse insulin ELISA, #10-1247-01, Mercodia, Sweden) following manufacturer’s instructions in plasma sampled in the saphenous vein after the 6-hour fasting during the GTT test. -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in Frontiers in Physiology doi: 10.3389/fphys.2019.00556Quote: ... 5’-ATCGAGTGCGATCACAAGCAG-3’ (1st PCR) and 5’-ACTCTCAGATTCCGGATTCACC-3’ (2nd PCR) using 5’-Full RACE Kit (TAKARA). For the 3’ RACE ... -
Molecular Devices
No products found because this supplier's products are not listed.bioRxiv - Animal Behavior and Cognition 2019, published in Matters doi: 10.19185/matters.201906000003Quote: ... ELISA plates were read at 450 nm on a plate reader (Molecular Devices). Specific concentrations for each sample were determined as mean absorbance using a standard curve of samples ranging from 0 to 8000 pg/ml. -
Crystal Chem
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.2006578117Quote: ... ELISA kit (Crystal Chem Inc.) was used to measure plasma insulin levels ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in Nature Communications doi: 10.1038/s41467-019-13864-1Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ... -
Tecan
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0225869Quote: ... Absorbance was read at 550 nm in an ELISA plate reader (Sunrise, Tecan, Milan, Italy), and the results expressed as relative change with respect to the controls set as 100%. -
Illumina
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2019, published in Nature Biotechnology doi: 10.1038/s41587-019-0150-yQuote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ... -
Elabscience Biotechnology
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019Quote: ... and AVP (catalogue number: ADI-900-017A) levels were quantified by using a competitive enzyme-linked immunosorbent assay (ELISA) kits (Elabscience, China and Enzo Life Sciences, USA). All assays were performed according to the manufacturers’ guidelines with the lowest assay sensitivity limit of approximately 3.9pg/ml ... -
BMG Labtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2017, published in Immunology and Cell Biology doi: 10.1111/imcb.12041Quote: ... ELISA plates were read using a FLUOstar Optima plate reader (BMG LabTech). -
Merck
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... according to the manufacturer’s instructions (Mouse Leptin ELISA Kit, 90030; Crystal Chem, Zaandam, Netherlands; Rat/Mouse Insulin ELISA Kit, cat. EZRMI-13K; Merck Millipore). The intra- and interassay coefficients of variation (CVs ... -
Promega
No products found because this supplier's products are not listed.Cited in Activation of the TRKB receptor mediates the panicolytic-like effect of NOS inhibitor aminoguanidinebioRxiv - Neuroscience 2018, published in Progress in Neuro-Psychopharmacology and Biological Psychiatry doi: 10.1016/j.pnpbp.2019.04.007Quote: The BDNF levels in the PAG samples were assessed by commercial sandwich ELISA kit (Promega, #G7610, USA) according to the manufacturer’s instructions ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Genomics 2019Quote: ... Plates were sealed with a plate-loc (Agilent) and centrifuged for additional 20 min allowing cells to settle on the pre-dispensed gel ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Mouse albumin ELISA kit (Bethyl Lab, Hamburg, Germany), paraformaldehyde (Merck ... -
Peprotech
No products found because this supplier's products are not listed.bioRxiv - Pathology 2020Quote: ... IL-8 ELISA kits were from Peprotech (London) -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2019, published in PLOS ONE doi: 10.1371/journal.pone.0218494Quote: ... Phospho-VEGFR-2 (Tyr1175) Sandwich ELISA Kit was from Cell Signaling Technology. Mouse albumin ELISA kit (Bethyl Lab ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Synthetic Biology 2020, published in Nature Communications doi: 10.1038/s41467-020-16574-1Quote: ... Plates were incubated at 37° C and imaged after 20 h with an Amersham Typhoon 5 Biomolecular Imager (GE Healthcare) using the following settings ... -
Lonza
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in Cell Stem Cell doi: 10.1016/j.stem.2018.07.004Quote: ... Mycoplasma detection tests were conducted routinely every month with MycoALERT ELISA based kit (Lonza) to exclude mycoplasma free conditions and cells throughout the study. -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... A 5′ Cy5 fluorescent label was incorporated using the 5′ EndTag kit (Vector Labs) according to the manufacturer’s instructions ... -
Stemcell Technologies
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... 5% CO2 and ambient oxygen level on Geltrex coated plates in mTeSR1 medium (STEMCELL Technologies, 05850) with daily medium change ... -
Macherey-Nagel GmbH
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in Proceedings of the National Academy of Sciences doi: 10.1073/pnas.1908180116Quote: ... Cell aggregates were lysed on plate using 350 μL RA1 (NucleoSpin® RNA kit (Macherey-Nagel) buffer with 3,5 μL β-mercaptoethanol (Sigma-Aldrich ... -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2019, published in PLOS ONE doi: 10.1371/journal.pone.0222685Quote: ... 50 ul of the conditioned medium from each transfection was incubated in one well of a 96-well ELISA plate (UltraCruz® ELISA Plate, high binding, 96 well, Flat bottom, Santa Cruz Biotechnology) at 37°C for 1 hr to allow protein in the media to adsorb to the plates ... -
Lucigen
No products found because this supplier's products are not listed.Cited in Expression of the miR-302/367 microRNA cluster is regulated by a conserved long non-coding host genebioRxiv - Genetics 2018Quote: Rapid Amplification of cDNA Ends (RACE) for the 5’ and 3’ ends was performed using ExactSTART™ Eukaryotic mRNA 5′- & 3′-RACE Kit (Epicentre). For 5’-RACE “mmiR-302 t Rev4” was used as reverse and internal primer ... -
Eppendorf
No products found because this supplier's products are not listed.Cited in Protein aggregation capture on microparticles enables multi-purpose proteomics sample preparationbioRxiv - Biochemistry 2018, published in Molecular & Cellular Proteomics doi: 10.1074/mcp.TIR118.001270Quote: ... 5% TFA) was added to eluted peptide mixture in Protein LoBind 96 well plate (Eppendorf) at 1:1 volume ratio ... -
VWR
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2018Quote: ... 5×105 cells/ml for HCT 116) was cultured in an ultra-low attachment 96-well plate (VWR, 29443-034) to form the multicellular spheroid ... -
Cell Biolabs
No products found because this supplier's products are not listed.bioRxiv - Pharmacology and Toxicology 2019Quote: ... MDA-HDL ELISA kit was purchased from Cell Biolabs Inc ... -
MyBioSource
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2021Quote: ... The P1NP level measurement ELISA kit was purchased from Mybiosource.com (Catalog No ... -
Beckman
No products found because this supplier's products are not listed.bioRxiv - Physiology 2019Quote: ... Agencourt AMPure XP PCR purification kit (5 ml Beckman Coulter Part No ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in Cell Reports doi: 10.1016/j.celrep.2019.03.080Quote: ... 5 × 107 bone marrow cells were lineage depleted (Mouse Lineage depletion kit, Miltenyi Biotec 130-090-858). Cells were stained with FcγR-BUV395 ... -
Leica
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2020, published in Toxics doi: 10.3390/toxics8040107Quote: ... distribution of FD10 in the AVP and CVP were imaged with dual channel confocal (Leica SP8, Germany) or inverted fluorescence microscopy (Olympus ... -
Bioline
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019, published in Pest Management Science doi: 10.1002/ps.5785Quote: ... with total reaction volume of 10 μl containing 5 μl Rotor-Gene SYBR® Green PCR Kit (Bioline, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ... -
Mabtech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020, published in Translational Research doi: 10.1016/j.trsl.2020.09.003Quote: Immunoglobulins (Ig) in culture supernatants were measured using a human IgG ELISA development kit (Mabtech) according to manufacturer’s instructions ... -
Sarstedt
No products found because this supplier's products are not listed.bioRxiv - Physiology 2018, published in The Journal of Experimental Biology doi: 10.1242/jeb.185884Quote: ... and 100 µL of this antibody solution was applied into each well of a high-binding 96-well ELISA plate (Sarstedt Inc., Montreal, QC) and incubated overnight at 4°C ...