-
No products found
because this supplier's products are not listed.
Xiaoning Gao, et al.,
bioRxiv - Cell Biology 2024
Quote:
... ELISA kits from Solarbio, catalogue numbers SEKR-0002 ...
-
No products found
because this supplier's products are not listed.
Atsushi Sugimoto, et al.,
bioRxiv - Microbiology 2022
Quote:
ELISA Kit (41135-1, PBL Assay Science, USA) and the Human IL-29/IL-28B (IFNλ1/3 ...
-
No products found
because this supplier's products are not listed.
Kelsey Voss, et al.,
bioRxiv - Immunology 2021
Quote:
Autoantibodies were measured with ELISA kits purchased from Alpha Diagnostics: Anti-Histone Total Ig ...
-
No products found
because this supplier's products are not listed.
Geneviève Jolivet, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Anti Müllerian hormone levels were determined in 50 μl aliquots of serum samples by using an ELISA kit (AMH GenII ELISA, with AMH Gen II calibrators and controls, Beckman Coulter, Villepinte, France) as previously described (Bourdon et al ...
-
No products found
because this supplier's products are not listed.
Qingwen Qian, et al.,
bioRxiv - Physiology 2022
Quote:
... were measured using commercially available ELISA kits (TSH ELISA kit, G-Biosciences, Cat No. IT6045; free T3 ELISA kit, G-Biosciences, Cat No. IT5691; T4 ELISA kit, G-Biosciences, Cat No ...
-
No products found
because this supplier's products are not listed.
Ziyi Zhang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Add 100 μL Working Biotin Conjugate Antibody (Rat IL-6 ELISA Kit, RK00020; Rat IL-1β ELISA Kit, RK00009; Rat IL-10 ELISA Kit, RK00050, Abclonal, China) in each well ...
-
AdvanStain Scarlet is a fluorescent stain for gels and blots that allows sensitive and...
Cat# K-11072-C25,
25 ml, USD $695.00/ea
Ask
Yian Guan, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... or WesternBright Sirius Chemiluminescent Detection Kit (Advansta) on ChemiDoc™ MP gel imaging analysis system (BioRad).
-
No products found
because this supplier's products are not listed.
Steven A. Cincotta, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... 5 μL of either WesternSure Pre-stained Chemiluminescent Protein Ladder (LI-COR #926-98000) or Chameleon Duo Pre-stained Protein Ladder (LI-COR #928-60000 ...
-
No products found
because this supplier's products are not listed.
Koki Yoshimoto, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Human HGF Quantikine ELISA (R&D, DHG00B) and Human MMP-9 Sandwich ELISA Kit (Proteintech, KE00164) were used for cell culture supernatants according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lavisha Parab, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... Plates were incubated for 5 hours at 37°C (Eppendorf Innova plate shaker) shaking at 750 rpm ...
-
No products found
because this supplier's products are not listed.
Elizabeth L. Doherty, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 5% CO2 in EGM-2 Bullet Kit (Lonza CC-3162) medium and used between passages 4-8.
-
No products found
because this supplier's products are not listed.
Delphine Leclerc, et al.,
bioRxiv - Genetics 2022
Quote:
RNA extraction was performed from frozen tissue in culture plates (P6 well plate, Falcon®) by using the NucleoSpin RNA kit (Macherey-Nagel). RNA concentration was measured with NanoDrop1000 spectrophotometer (Thermo Scientific) ...
-
No products found
because this supplier's products are not listed.
Oscar R. Hernández-Pérez, et al.,
bioRxiv - Neuroscience 2022
Quote:
... AVP + V1a antagonist (1 ng AVP +30 ng Manning compound (V1a antagonist, Bachem, USA)) and AVP + V1b antagonist (1 ng AVP + 10 ng SSR149415 (V1b antagonist ...
-
No products found
because this supplier's products are not listed.
Anita E Autry, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Primary antibody Rabbit anti-vasopressin (Immunostar) or Rabbit anti-oxytocin (Millipore ...
-
No products found
because this supplier's products are not listed.
Sevasti Gaspari, et al.,
bioRxiv - Physiology 2022
Quote:
... AVP-IRES2-cre-Dtg/+ mice were generated by crossing the Tmem117fl line with the AVP-IRES2-cre-D (Jackson Laboratory code: 023530) for verifying the specificity of the Tmem117 antibody (Fig 1C,D).
-
No products found
because this supplier's products are not listed.
Ross Peterson, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
A Sandwich ELISA (Bovine Lactoferrin ELISA kit, NBP3-12185, Novus Biologicals) was used and adopted to determine bovine lactoferrin concentrations in rat serum ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... RANKL and insulin were measured by mouse Osteocalcin ELISA Kit (BioVision), OPG ELISA Kit (Boster Biological Technology) ...
-
Single well glass bottom plate with high performance #1.5 cover glass (0.170±0.005mm). Black...
Cat# P01-1.5H,
20/case, $249.00
Ask
Lissenya B. Argueta, et al.,
bioRxiv - Cell Biology 2021
Quote:
... hESC-qualified)-coated plates at 4×10^5/well in 24-well plates or 3×10^4/well in glass-like polymer bottom 96-well plates (CellVis).
-
No products found
because this supplier's products are not listed.
Benjamin J. Meckiff, et al.,
bioRxiv - Immunology 2020
Quote:
... plated in 6-well culture plates at a concentration of 5 × 106 cells/ml in 1 ml of serum-free TexMACS medium (Miltenyi Biotec) and left overnight (5 % CO2 ...
-
No products found
because this supplier's products are not listed.
Rebecca S. Hofford, et al.,
bioRxiv - Neuroscience 2020
Quote:
A morphine ELISA kit (Abnova #KA0935) was used to quantify morphine in serum and DStr ...
-
No products found
because this supplier's products are not listed.
Kyung In Baek, et al.,
bioRxiv - Bioengineering 2020
Quote:
... distribution of FD10 in the AVP and CVP were imaged with dual channel confocal (Leica SP8, Germany) or inverted fluorescence microscopy (Olympus ...
-
No products found
because this supplier's products are not listed.
Soumik Barman, et al.,
bioRxiv - Immunology 2022
Quote:
... IFNβ was measured with a bioluminescent ELISA kit (LumiKine, Invivogen). For experiments involving blocking antibodies (Abs) ...
-
No products found
because this supplier's products are not listed.
Emanuele Roscioli, et al.,
bioRxiv - Microbiology 2024
Quote:
... ELISA plates were coated with 2 µg/ml of goat anti-human IgG (Southern Biotech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
David Camerini, et al.,
bioRxiv - Immunology 2023
Quote:
... ELISA plates were coated overnight with rabbit anti human Fc gamma chain-specific antibody (Jackson ImmunoResearch). Plates were then washed with DPBS ...
-
No products found
because this supplier's products are not listed.
Sevasti Gaspari, et al.,
bioRxiv - Physiology 2022
Quote:
The p2.0VPI.icre (AVP-icre) plasmid was generated by subcloning the iCre sequence (AgeI 2732nt, NotI 3813nt) from pCDH-CB-iCre plasmid (Addgene # 72257) in the p2.0VPI.EGFP backbone (AgeI 6237nt ...
-
No products found
because this supplier's products are not listed.
Pedro de los Reyes, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and 5-µL of SensiFAST SYBR & Fluorescein Kit (Bioline). Each sample was measured in triplicate ...
-
No products found
because this supplier's products are not listed.
Matthew G. Durrant, et al.,
bioRxiv - Genetics 2024
Quote:
... RNA was purified using RNA Clean & Concentrator - 5 kit and subsequently treated with RNA 5′ Polyphosphatase (Lucigen) for 30 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
Gururaj Shivange, et al.,
bioRxiv - Biochemistry 2021
Quote:
... For coating 96-well ELISA plates (Olympus), the protein solutions (2μg/ml ...
-
No products found
because this supplier's products are not listed.
Zhiqing Huang, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Enzyme-linked immunosorbent assays (ELISA) using the human POSTN ELISA kit from Aviva Systems (Cat # OKCD09048 ...
-
No products found
because this supplier's products are not listed.
Yuji Matsumoto, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
The phosphorylated neurofilament H ELISA kit (BioVendor Laboratorni Medicina AS ...
-
No products found
because this supplier's products are not listed.
Hassan Nassour, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... The IP-One ELISA assay kit from CisBio Bioassays ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, Patrick O. McGowan,
bioRxiv - Neuroscience 2020
Quote:
... was measured in the pup serum (n = 5-7 per group) using an ELISA (MP Biomedicals Inc., USA) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yan Fang, et al.,
bioRxiv - Genetics 2023
Quote:
800 C3H/10T1/2 cells were seeded in a 96 well plate (glass bottom culture plates, MatTek, PBK96G-1.5-5-F) and keep cells in 37-degree for 24 h ...
-
No products found
because this supplier's products are not listed.
Lannah S. Abasi, et al.,
bioRxiv - Biophysics 2023
Quote:
... Samples (5 µL) were placed in a µ-Slide 18-well glass bottom multi-well plate (Ibidi) for imaging and were allowed to settle for 5-10 minutes ...
-
No products found
because this supplier's products are not listed.
Rana Soylu-Kucharz, et al.,
bioRxiv - Neuroscience 2023
Quote:
... vasopressin (1:10000, Chemicon) and oxytocin (1:2000, Phoenix Pharmaceuticals), anti-hypocretin (1:4000 ...
-
No products found
because this supplier's products are not listed.
Juan Pablo Arroyo, et al.,
bioRxiv - Physiology 2022
Quote:
... using 2.5 ug of pCMV6-XL5 or pCMV6-XL5-AVP (Origene) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... were assayed using ELISA using the Monkey IL12 ELISA Kit (LifeSpan BioSciences, Inc.), Monkey IFN alpha (pan ...
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Shenghui Xing, et al.,
bioRxiv - Microbiology 2021
Quote:
... Chemiluminescent detection was performed using an ECL fluorescence colorimetric kit (Tiangen) and fluorescent signals were visualized using a Bio-Rad Gel Doc XR ...
-
No products found
because this supplier's products are not listed.
Alice Wedler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Plates were analyzed 5 days post seeding using an Incucyte S3 (Sartorius). Additionally ...
-
No products found
because this supplier's products are not listed.
John Lees, et al.,
bioRxiv - Molecular Biology 2023
Quote:
MeDIP-Seq libraries for Ion Torrent semiconductor sequencing were performed on the Ion Torrent PGM using a modified protocol from Ion Plus Fragment Library kit (Catalog # 4471252) combined with a 5-hydroxymethylcytosine (5hmC Kit, Catalog # AF-110–0016) immunoprecipitation kit (Diagenode) according to a previously optimized protocol (Guerrero-Bosagna & Jensen ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Brandon J. DeOre, et al.,
bioRxiv - Cell Biology 2020
Quote:
Commercial ELISA kits were purchased from Cytoskeleton (G-LISA) to quantify RhoA and Rac1 activation (Cytoskeleton) ...
-
No products found
because this supplier's products are not listed.
Audrey Caron, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and the TNF-α mouse ELISA kit (Biomatik, EKA51917), respectively ...
-
No products found
because this supplier's products are not listed.
Michael R. Perkinson, et al.,
bioRxiv - Neuroscience 2021
Quote:
Sections were imaged in Z-stacks at 570 nm for ΔN-TRPV1 mRNA and 620 nm for vasopressin mRNA on a confocal microscope (Nikon A1R MP). Stacks were compressed using ImageJ Fiji Z-projection Max intensity ...
-
No products found
because this supplier's products are not listed.
Zsuzsa Radvanyi, et al.,
bioRxiv - Physiology 2023
Quote:
... Commercial ELISA kits were employed to measure cFGF23 (Quidel, Cat. #60-6100) and iFGF23 (Quidel ...
-
No products found
because this supplier's products are not listed.
Darach Miller, Adam Dziulko, Sasha Levy,
bioRxiv - Systems Biology 2024
Quote:
Amino-acid additive stocks and selective plates with 5-FOA (GoldBio), hygromycin ...
-
No products found
because this supplier's products are not listed.
Chunsheng Zhou, et al.,
bioRxiv - Immunology 2020
Quote:
... and plate-bound α-CD3 (clone 145-TC11, 5 ug/ml; BioXCell) in complete RPMI medium supplemented with 10% fetal bovine serum ...
-
No products found
because this supplier's products are not listed.
Yiming Liu, et al.,
bioRxiv - Plant Biology 2019
Quote:
... The chemiluminescent signals were exposed to autoradiography film (Genesee Scientific, SanDiego, CA) using a Kodak film processor SuperSignal West Pico Chemiluminescent Sbustrate (Prod # 1856136 ...
-
No products found
because this supplier's products are not listed.
Johnathan Abou-Fadel, et al.,
bioRxiv - Systems Biology 2019
Quote:
... 5 µm (Phenomenex) column ...