-
No products found
because this supplier's products are not listed.
Juanjuan Yuan, et al.,
bioRxiv - Immunology 2020
Quote:
... anti-Apolipoprotein B (Abcam), anti-PCSK9 (Sino Biological ...
-
No products found
because this supplier's products are not listed.
Mengna Li, Shujing Li, Luoying Zhang,
bioRxiv - Cell Biology 2023
Quote:
... mouse anti-PP2A catalytic subunit (1:1000, Millipore) and guinea pig anti-PER (1:1000 ...
-
No products found
because this supplier's products are not listed.
Jan Steinkühler, et al.,
bioRxiv - Biophysics 2020
Quote:
... Cholera toxin subunit B – Alexa Fluor 488 (Invitrogen) at 16.7 nM ...
-
No products found
because this supplier's products are not listed.
Spencer A. Haws, et al.,
bioRxiv - Biochemistry 2023
Quote:
... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
No products found
because this supplier's products are not listed.
Pojeong Park, et al.,
bioRxiv - Neuroscience 2020
Quote:
... a catalytic subunit of protein kinase A (PKA Cα, New England Biolabs); Ca2+/calmodulin-dependent protein kinase II (CaMKII ...
-
No products found
because this supplier's products are not listed.
Xiaocheng Zhao, et al.,
bioRxiv - Biochemistry 2019
Quote:
... catalytic subunit (Promega V5161) (1nM ...
-
No products found
because this supplier's products are not listed.
Anna Kirjavainen, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 2% Choleratoxin B subunit (#104; List Biological Lab.Inc.) were injected at the speed of 50 nl/min using a microinjector (UltraMicroPump III ...
-
No products found
because this supplier's products are not listed.
Jasper Che-Yung Chien, et al.,
bioRxiv - Genetics 2020
Quote:
... DNA-dependent protein kinase catalytic subunit (DNA-PKcs) antibody was obtained from Santa Cruz (sc-5282, Dallas, TX, USA) and anti-phosphorylated DNA-PKcs was purchased from Abcam (ab124918 ...
-
No products found
because this supplier's products are not listed.
Si-Han Chen, et al.,
bioRxiv - Cell Biology 2023
Quote:
The Ub(K48R)-IBM and Ub(K48R)ΔLRGG-IBM expression constructs were generated by gene synthesis and cloned to a Tet-on 3G inducible PiggyBac vector using In-Fusion HD enzyme (Clontech). The IgA2 and its IBM mutant constructs were cloned to a PCDNA3.1 vector under the control of a CMV promoter ...
-
No products found
because this supplier's products are not listed.
Muhammed Jamsheer K, et al.,
bioRxiv - Plant Biology 2020
Quote:
... and incubated with 1.5 μg anti-SnRK1α1 antibody (SNF1-related protein kinase catalytic subunit alpha KIN10 antibody; catalog no.: AS10 919, Agrisera) in 600 μL PBS on a rotator shaker for 1 h at room temperature with gentle shaking ...
-
No products found
because this supplier's products are not listed.
Bonah Kim, et al.,
bioRxiv - Immunology 2021
Quote:
... and anti-PP2A-B subunit antibodies (Abs) were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-PP2A-C and anti-β-actin Ab was obtained from MilliporeSigma (Burlington ...
-
No products found
because this supplier's products are not listed.
Jawad S Khalil, et al.,
bioRxiv - Cell Biology 2023
Quote:
... IgG2b clone 18), IIα (612243, IgG1 clone 40), IIβ (610626, IgG1 clone 45), and catalytic-α subunit (610980, IgG2b clone 5B) from BD biosciences (Wokingham ...
-
No products found
because this supplier's products are not listed.
E. Nicholas Petersen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 4 ug/mL apolipoprotein E3 (BioLegend, USA) was mixed with fresh 10% FBS and applied to the cells for 1hr prior to shear and or fixing.
-
No products found
because this supplier's products are not listed.
Anna D. Kashkanova, et al.,
bioRxiv - Biophysics 2022
Quote:
Human Apolipoprotein B Quantikine ELISA Kit (R&D Systems, DAPB00) was used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Donghyung Lee, Lillian Liu, Cory M. Root,
bioRxiv - Neuroscience 2023
Quote:
... 100 nl of Cholera Toxin Subunit B CF 488A (Biotium) was injected at into the caudal portion of the ventrolateral VP (AP ...
-
No products found
because this supplier's products are not listed.
Xin Zhang, et al.,
bioRxiv - Pharmacology and Toxicology 2020
Quote:
... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
No products found
because this supplier's products are not listed.
Joana Enes, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and rabbit anti-S100 calcium-binding protein B β-subunit (S100-β) polyclonal antibody (Agilent Dako ...
-
No products found
because this supplier's products are not listed.
Richard A. Voit, et al.,
bioRxiv - Cell Biology 2022
Quote:
... The effect on MECOM mRNA after editing was detected by qRT-PCR using SYBR green (Biorad) after cDNA synthesis with iScript (Biorad).
-
No products found
because this supplier's products are not listed.
Andrew J. Suh, et al.,
bioRxiv - Cell Biology 2023
Quote:
... gp120 of HIV-2 Group M Subunit B (Catalog number 40404-V08H, Sino Biological), S1 of SARS CoV-2 spike protein (Catalog number 40591-V08H ...
-
No products found
because this supplier's products are not listed.
Garfield T. Kwan, et al.,
bioRxiv - Physiology 2023
Quote:
... VHA was immunodetected using custom-made rabbit polyclonal antibodies against a highly conserved epitope within subunit B (epitope: AREEVPGRRGFPGY; GenScript, Piscataway, USA). Both NKA and VHA antibodies have been validated in the inner ear of splitnose rockfish (24 ...
-
No products found
because this supplier's products are not listed.
Tom Lemonnier, et al.,
bioRxiv - Cell Biology 2019
Quote:
... PP6 catalytic subunit (1:500, Bethyl A300-844A) and GST (1:10,000 ...
-
No products found
because this supplier's products are not listed.
David B. Melville, Sean Studer, Randy Schekman,
bioRxiv - Cell Biology 2020
Quote:
Commercially available antibodies used for immunoblotting were as follows: Goat anti-apolipoprotein B (EMD, Hayward, CA; #178467 1:500 for immunoblot) (Figure 6A) Rabbit anti-apolipoprotein B (Proteintech Rosemont, IL #20578-1-AP)(Figure 6B).
-
No products found
because this supplier's products are not listed.
Youssef El Laithy, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... 25ng/mL cholera toxin subunit B (Sigma/Merck, C9903-.5MG), 0.5µg/mL hydrocortisone (Sigma/Merck ...
-
No products found
because this supplier's products are not listed.
Esther Zumaquero, et al.,
bioRxiv - Immunology 2019
Quote:
... 300 ng of total RNA from three biological replicates per B cell subset was used as input for the KAPA stranded mRNA-seq Kit with mRNA capture beads (KAPA Biosystems). Libraries were assessed for quality on a bioanalyzer ...
-
No products found
because this supplier's products are not listed.
Catherine W. Cai, et al.,
bioRxiv - Immunology 2020
Quote:
... and B6.129S6-Cybbtm1Din/J mice lacking the gp91phox catalytic subunit of NADPH oxidase (gp91phox KO, The Jackson Laboratory) were obtained directly from the vendor or maintained as breeding colonies within the Hoft laboratory ...
-
No products found
because this supplier's products are not listed.
Ya-Juan Wang, et al.,
bioRxiv - Cell Biology 2023
Quote:
... or γ2 subunit (Synaptic Systems, Goettingen ...
-
No products found
because this supplier's products are not listed.
Laure Nicolas Annick Ries, et al.,
bioRxiv - Microbiology 2021
Quote:
... Libraries were prepared using the TruSeq®Stranded mRNA LT Set B kit (Illumina) and sequenced (2×100bp ...
-
No products found
because this supplier's products are not listed.
Abulaish Ansari, et al.,
bioRxiv - Physiology 2023
Quote:
... apolipoprotein B (apoB) were measured using immuno-turbidimetric assays (Beckman Coulter (UK), Ltd) ...
-
No products found
because this supplier's products are not listed.
Maggie Jing Ouyang, et al.,
bioRxiv - Microbiology 2023
Quote:
... S1 subunit (RayBiotech, Cat# 230-01101), and S2 subunit (RayBiotech ...
-
No products found
because this supplier's products are not listed.
Samantha L Scudder, et al.,
bioRxiv - Neuroscience 2019
Quote:
Anti-20S core α subunits monoclonal mouse antibody (mAb MCP231) and Rpt6 regulatory subunit monoclonal mouse antibody (mAb p45-110) were purchased from Enzo Life Sciences. Custom rabbit (pAb ...
-
No products found
because this supplier's products are not listed.
Weaam I. Mohamed, et al.,
bioRxiv - Biochemistry 2021
Quote:
... using Superdex Peptide PC 3.2/300 (for the 5-subunit hGID complex) or Superdex 30 Increase 3.2/300 (for the 6-subunit hGID complex) columns (both GE Healthcare). Three high-mass fractions enriched in cross-linked peptide pairs were collected for MS analysis.
-
No products found
because this supplier's products are not listed.
Jin Wook Hwang, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... hooked to a computer for image processing and editing (Leica DC 300). Ultra thin sections of about 60/90 nm were contrasted with heavy metals (uranyl acetate and lead citrate ...
-
No products found
because this supplier's products are not listed.
Kewa Gao, et al.,
bioRxiv - Genetics 2022
Quote:
... Cas9 mRNA and Cre mRNA were purchased from TriLink BioTechnologies ...
-
No products found
because this supplier's products are not listed.
Blessy Paul, et al.,
bioRxiv - Cell Biology 2024
Quote:
... goat anti-Apolipoprotein B (1:200, Rockland immunochemicals, 600-101-111) and mouse anti-ceramide (1:50 ...
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and human Apolipoprotein E ε3 (Peprotech), at 1 ug/mL for all antigens ...
-
No products found
because this supplier's products are not listed.
Ronak Lakhia, et al.,
bioRxiv - Genetics 2022
Quote:
... The following antibodies were used: DBA (Vector Labs, catalog# B-1035), THP (Biomedical Technologies ...
-
No products found
because this supplier's products are not listed.
Guoyu Yu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... were cut into small pieces and digested with in 2.4 mL of dissociation solution [DMEM medium supplemented with enzyme mixture (100ul Enzyme D, 50uL Enzyme R and 12.5uL Enzyme A)] using Tumor Dissociation Kit (Miltenyi Biotec). After incubation for 45 minutes at 37°C ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... difficile binary toxin subunit B capture and detection antibodies (MyBiosource) were used following the supplier’s instructions.
-
No products found
because this supplier's products are not listed.
Bobbie Pelham-Webb, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... either 10uM p300/CBP catalytic inhibitor (A485, Tocris #6387) or the same volume DMSO was added to the media for the remaining 3 hours of synchronization ...
-
No products found
because this supplier's products are not listed.
Yi-Wen Chang, et al.,
bioRxiv - Systems Biology 2020
Quote:
... ATP synthase β subunit (GeneTex), HA-tag (BioLegend ...
-
No products found
because this supplier's products are not listed.
Alicia Garcia-Gimenez, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CREBBPR1446C gene-editing reagents were introduced by nucleofection (Nucleofector II, Kit R, Lonza) consisting of a gRNA/Cas9 RNP complex (IDT 1072532 ...
-
No products found
because this supplier's products are not listed.
Núria Catasús, et al.,
bioRxiv - Cell Biology 2023
Quote:
CRISPR/Cas9 editing was performed with the ArciTect ribonucleoprotein (RNP) system (STEMCELL Technologies). The designed sgRNA targeted exon 2 of the NF2 gene (GTACACAATCAAGGACACAG ...
-
No products found
because this supplier's products are not listed.
Brooke Rathie, et al.,
bioRxiv - Microbiology 2022
Quote:
... and 3g of cycloheximide (Cayman Chemicals 14126), in 750ml of demineralized water ...
-
No products found
because this supplier's products are not listed.
Inkyu Lee, et al.,
bioRxiv - Bioengineering 2023
Quote:
... a 3D-printed reservoir was glued on the catalytic array chip using polydimethylsiloxane (Dow Corning, Sylgard 184). Pt wire and 1 M Ag/AgCl electrodes served as counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Sergej Franz, et al.,
bioRxiv - Microbiology 2020
Quote:
... In vitro transcribed full-length CHIKV mRNA and mRNA encoding single viral proteins was transfected into target cells with the TransIT mRNA kit (Mirus). MAYV (strain TRVL15537 ...
-
No products found
because this supplier's products are not listed.
José Manuel Ezquerra-Aznárez, et al.,
bioRxiv - Microbiology 2021
Quote:
... hygromycin B (Invivogen) was added at 20 μg/mL ...
-
No products found
because this supplier's products are not listed.
Rayane Dibsy, et al.,
bioRxiv - Microbiology 2022
Quote:
... Latrunculin B (Calbiochem), Jasplakinolid (Calbiochem) ...
-
No products found
because this supplier's products are not listed.
Dan Liu, et al.,
bioRxiv - Microbiology 2020
Quote:
... The chemiluminescence catalytic activity was assessed by EnVision Multilabel plate reader (PerkinElmer) using a liquid auto-injection system and luminol substrate ...
-
No products found
because this supplier's products are not listed.
Sarah L. Olguin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... mRNAs were purified after removal of rRNA (mRNA-ONLY™ Eukaryotic mRNA Isolation Kit, Epicentre Biotech., WI). Fluorescently labeled cRNAs derived from these transcripts were used to probe Agilent Mouse V4.0 LncRNA Array containing probes for 22,692 mRNAs (ArrayStar ...
-
No products found
because this supplier's products are not listed.
M. Fenu, et al.,
bioRxiv - Biophysics 2023
Quote:
... human fibrinogen (Enzyme Research Laboratories, plasma purified ...