-
No products found
because this supplier's products are not listed.
Marie O. Pohl, et al.,
bioRxiv - Microbiology 2021
Quote:
... A mouse (#Ab00458-1.1) or rabbit (Ab00458-23.0) anti-dsRNA antibody (9D5; Lucerna-Chem) was used to stain for SARS-CoV-2 infected cells ...
-
No products found
because this supplier's products are not listed.
David Veysset, et al.,
bioRxiv - Bioengineering 2021
Quote:
... on top of a 1-inch borosilicate glass substrate (n°2 coverslip, ChemGlass) (Layer 5) ...
-
No products found
because this supplier's products are not listed.
Daiana Martire-Greco, et al.,
bioRxiv - Immunology 2021
Quote:
... conditioned media (CM) were collected and incubated for 2 h with an anti-Stx antibody (anti-Stx2 variant from Toxin Technology, USA) to block the direct effect of Stx ...
-
No products found
because this supplier's products are not listed.
Rocío del M. Saavedra-Peña, et al.,
bioRxiv - Physiology 2022
Quote:
... Cells were then stained with anti-BrdU antibody (Alexa Fluor 647; Phoenix Flow Systems; AX647) at 1:30 in HBSS with 3% BSA overnight in the dark at 4C ...
-
No products found
because this supplier's products are not listed.
Dara Bree, et al.,
bioRxiv - Neuroscience 2019
Quote:
... a 96-well plate was coated with a mouse anti-CGRP capture antibody (Bertin Bioreagent) and incubated overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the N-terminal tag was removed by incubation with HRV 3C protease (AG Scientific) and further purified by Superose 6 column ...
-
No products found
because this supplier's products are not listed.
Samim Ali Mondal, et al.,
bioRxiv - Physiology 2022
Quote:
... (4) CCl4 + 17α preventive (n=18): chow+17α (14.4 mg/kg; Steraloids, Newport, RI)-fed for eight weeks while simultaneously being CCl4-treated twice weekly for eight weeks ...
-
No products found
because this supplier's products are not listed.
Sanchita Bhadra, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... SARS-CoV-2 N gene armored RNA was obtained from Asuragen (Austin, TX, USA). SARS-CoV-2 viral genomic RNA was obtained from American Type Culture Collection (Manassas ...
-
No products found
because this supplier's products are not listed.
Nicolas Gutierrez-Castellanos, et al.,
bioRxiv - Neuroscience 2023
Quote:
... N=4) at 27.6 nL/min using a nanoliter injector (Nanoject II, Drummond Scientific) at 0.1 Hz ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Jonathan L. Schmid-Burgk, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using primers and probes against the N-gene (N_Sarbeco_F: CACATTGGCACCCGCAATC, N_Sarbeco_R: GAGGAACGAGAAGAGGCTTG, N_Sarbeco_P: FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ, TIB MolBiol). Spike-in RNA of the bacteriophage MS2 served as an interal control and was detected with Luna® Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
No products found
because this supplier's products are not listed.
Michel Engeln, et al.,
bioRxiv - Neuroscience 2019
Quote:
... mice were injected with 0.5mg/kg clozapine-N-oxide (i.p.; LKT Laboratories, St. Paul, MN, USA) 30 min prior to behavioral testing.
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Isabella Santi, et al.,
bioRxiv - Microbiology 2023
Quote:
... optimized from the condition n° 86 of the commercial screen NeXtal PEG suit HT (Molecular dimensions). NatR-NatT was crystallized in 0.2 M Sodium sulfate 0.1 M Bis-Tris propane 7.5 20% w/v PEG 3350 from the crystallization screen Pact Premier (Molecular dimensions ...
-
No products found
because this supplier's products are not listed.
Bojana Kokinovic, et al.,
bioRxiv - Neuroscience 2024
Quote:
... equipped with LUMPlanFL N 40x/0.8w water immersion objective and Prime BSI Express sCMOS camera (Teledyne Photometrics). CoolLED pE-300 was used as a source of green/blue light ...
-
No products found
because this supplier's products are not listed.
Jasmine Alexander-Floyd, et al.,
bioRxiv - Immunology 2021
Quote:
... supernatants and recombinant cytokine standards were applied to anti-IL-1β antibody-coated (eBioscience) Immulon ELISA plates (ImmunoChemistry Technologies). IL-1β was detected using biotinylated anti IL-1β (eBioscience ...
-
No products found
because this supplier's products are not listed.
Sylvain Perriot, et al.,
bioRxiv - Immunology 2024
Quote:
... transfected Jurkat cells and co-culture with HLA-unenhanced neurons or in presence of a blocking anti-HLA ABC antibody (W6/32, AffinityImmuno). Luminescence was measured with a Multimode Microplate Reader (BioTek Synergy) ...
-
No products found
because this supplier's products are not listed.
Shan Zhao, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 200 mM SDS and 25% w/v N-Methyldiethanolamine) at 37 °C on a shaking rocker (IKA, 2D digital). The solutions were refreshed when the color changed to green until colorless ...
-
No products found
because this supplier's products are not listed.
Dewi Safitri, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... HEK293T cells overexpressing full-length GIPR or GLP-1R with an N-terminal FLAG tag were purchased from Multispan, Inc (Hayward ...
-
No products found
because this supplier's products are not listed.
Kevin Burbidge, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The grid was then probed with donkey anti-mouse antibody conjugated to 20nm gold particles 1:200 (Cytodiagnostics #AC-20-02), diluted in block solution for 30 minutes by flotation ...
-
No products found
because this supplier's products are not listed.
James Young, et al.,
bioRxiv - Microbiology 2019
Quote:
... or 12 h light/12 h dark cycle in ASPII N+ or ASP II N- (nitrogen-containing or nitrogen-free media) were transferred into a 20-ml glass serum bottle (Wheaton) respectively ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Koichi Sato, Aiko G.M. Hendrikx, Puck Knipscheer,
bioRxiv - Biochemistry 2023
Quote:
... The wild-type protein was overexpressed as a N-terminal His6-tagged protein in the E.coli JM109(DE3) cells (Intact Genomics) cultured in 4.4 L LB medium and purified by the previously described method53 ...
-
No products found
because this supplier's products are not listed.
Yu Han, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Fetal heart and postnatal hearts (n=5 each) were acquired commercially at E17.5 and P1 from Zyagen (San Diego, CA), weighed ...
-
No products found
because this supplier's products are not listed.
Anne Slavotinek, et al.,
bioRxiv - Genetics 2020
Quote:
... Neomycin phosphotransferase II (NPTII) expressed from NeoR cassette on pcDNA3-Exosc5 vectors was detected with anti-NPTII monoclonal antibody (1:1000; Cell Applications, Inc.). Primary antibodies were detected using goat secondary antibodies coupled to horseradish peroxidase (1:3000 ...
-
No products found
because this supplier's products are not listed.
Tawna L. Mangosh, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Hybridization with 333ng/mL of a TelC-Cy5-labeled peptide nucleic acid (PNA) oligonucleotide telomere probe (N-CCTAACCTAACCTAA-C, PNA BIO) in PNA buffer (10mM Tris pH 7.5 ...
-
No products found
because this supplier's products are not listed.
Philippe Marullo, et al.,
bioRxiv - Genetics 2019
Quote:
... Glucose and Fructose consumed were estimated by enzymatic assay using the kit n° 10139106035 according to manufacturer protocol (R-Biopharm, Germany) and the RS (Residual Sugars ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Gabriela Leite, et al.,
bioRxiv - Cell Biology 2021
Quote:
Primary human tracheal epithelial cells isolated from the surface epithelium of human trachea (HTEpC, lot n° 454Z019.11, PromoCell GmbH, Heidelberg, Germany) were cultured at 37°C (5% CO2 ...
-
No products found
because this supplier's products are not listed.
Xiaopeng Tang, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... FXa-AT-III complex was detected by incubation with HRP-conjugated anti-human AT-III antibody (1: 200, SAAT-APHRP, Enzyme Research Laboratory, USA). Relative level of TAT and FXa-AT-III complex was calculated.
-
No products found
because this supplier's products are not listed.
Lesia Rodriguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... Proteins immunoprecipitated with anti-FLAG antibody were separated by SDS-PAGE (4-15% Mini-PROTEAN®TGX™ Precast Protein Gels (Bio-RAD)) ...
-
No products found
because this supplier's products are not listed.
Lindsey M. Brier, Joseph P. Culver,
bioRxiv - Neuroscience 2021
Quote:
... The N=16 mice used for FC matrix computation had stainless steel EEG self-tapping screws (BASI Inc., West Lafayette, IN, USA) fixed at approximately -1mm posterior to bregma ...
-
No products found
because this supplier's products are not listed.
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
... The estradiol levels (n=4) were also measured using an ELISA assay (#ES180S-100 Calbiotech, detection range 3 to 300 pg/mL). The intra-assay variation was 5.9% in these assays.
-
No products found
because this supplier's products are not listed.
Boyang Zhao, et al.,
bioRxiv - Biochemistry 2023
Quote:
... and σNS-ΔN17 were subcloned into the bacterial expression vector pET28 with an N-terminal His tag and a TEV protease cleavage site (Epoch Life Science). Escherichia coli DE3 cells (Novagen ...
-
No products found
Jonathan H. Shrimp, et al.,
bioRxiv - Biochemistry 2020
Quote:
Recombinant Human TMPRSS2 protein expressed from Yeast (human TMPRSS2 residues 106-492, N-terminal 6x His-tag) (Cat # TMPRSS2-1856H) was acquired from Creative BioMart (Shirley, NY). Peptides obtained from Bachem include ...
-
No products found
because this supplier's products are not listed.
Bailey E. McGuire, et al.,
bioRxiv - Microbiology 2021
Quote:
Rabbit polyclonal antibodies (Kinexus Bioinformatics) directed against synthetic peptides based on SARS-CoV-2 proteins were used in dot blots and are as follows ...
-
No products found
because this supplier's products are not listed.
Sabrina Haas, et al.,
bioRxiv - Neuroscience 2023
Quote:
... All antibodies were diluted in antibody diluent (IW-1000, IHC World, LLC, Woodstock, MD, USA) and incubated for 1 hour at room temperature ...
-
No products found
because this supplier's products are not listed.
Edward A Meyer, Craig E Franklin, Rebecca L Cramp,
bioRxiv - Zoology 2020
Quote:
... gill arches and tail sections from acid naïve and acid acclimated larvae (N = 3 for each group) were mounted on stubs and coated with gold in a sputter coater (SPI Module; SPI Supplies, West Chester, PA, USA). Gills and tail sections were viewed and photographed with a Jeol JSM 6400 SEM.
-
No products found
because this supplier's products are not listed.
Shigeo Takashima, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... The following antibodies were used in this study (working dilution and other information in parentheses): rabbit anti-human catalase (1:500; Athens Research & Technology, Athens GA, #01-05-030000), rabbit anti-PMP70 (1:500 ...
-
No products found
because this supplier's products are not listed.
Lauren T. Gill, et al.,
bioRxiv - Biochemistry 2022
Quote:
... except for an ubiquitin specific primary antibody (1:1000 dilution; UBCJ2, Mono- and polyubiquinated conjugates monoclonal antibody, FroggaBio).
-
No products found
because this supplier's products are not listed.
Han Hao, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The following antibodies were used: VGAT C-terminal antibody (rabbit polyclonal #AB-N44, Advance Targeting System; 1:200); VGAT N-terminal antibody (rabbit polyclonal 131002 ...
-
No products found
because this supplier's products are not listed.
Amanda J. McLaughlin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-secretagogin (BioVendor, RD1884120100 ...
-
No products found
because this supplier's products are not listed.
Lanpeng Chen, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... anti-human Nanog and anti-human Oct-4 were obtained from Cell Science Signaling ...
-
No products found
because this supplier's products are not listed.
Guang Lin, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit anti-GlcCer (Glycobiotech; RAS_0010); Mouse anti-ATP5a (Abcam ...
-
No products found
because this supplier's products are not listed.
Tali Kiperman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Antibodies used were diluted in 5% milk (Labscientific CN: M0841). Primary and secondary antibodies with dilutions used are described in Suppl ...
-
No products found
because this supplier's products are not listed.
Simon N. Chu, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 3% antibody serum (heat-inactivated; Atlanta Biologicals, Flowery Branch, GA, USA), 2% human plasma (from umbilical cord blood) ...
-
No products found
because this supplier's products are not listed.
Joanna J. Moss, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and anti-mouse (G32-62G, 1:10,000, SignalChem) horseradish peroxidase-conjugated antibodies at room temperature for 1 hr before exposure on photographic film (28906844 ...
-
No products found
because this supplier's products are not listed.
Xiaowei Hou, et al.,
bioRxiv - Biochemistry 2020
Quote:
... The sequence of the antibody was determined by cDNA sequencing of hybridoma cells (SYD Labs). Intact IgG was expressed using mouse hybridoma cells ...
-
No products found
because this supplier's products are not listed.
Kim S. Friedmann, et al.,
bioRxiv - Immunology 2020
Quote:
... APC-labelled anti-MART-1 (ELAGIGILTV) dextramers (Immudex, 1:5), APC-labelled A*0201 dextramer negative control (Immudex ...
-
No products found
because this supplier's products are not listed.
Anna Voleníková, et al.,
bioRxiv - Genetics 2023
Quote:
... using 4′,6-diamidino-2-phenolindole (DAPI) (1.5 μg/mL in anti-fade; Cambio, Cambridge, UK) counterstaining ...