1 - 50 of 383
suppliers found for
Anti SHH Antibody
» view 10000+ matched products-
MedChemExpress Sponsored
Cat# HY-P70467-10 μg, 10 μg, USD $120.0 Ask
-
R&D Systems
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run. -
Santa Cruz
No products found because this supplier's products are not listed.bioRxiv - Physiology 2020Quote: ... mouse anti-Shh antibodies (Santa Cruz Biotechnology, Inc, Cat#sc-365112), rabbit-anti Hh antibodies (Santa Cruz Biotechnology ... -
Millipore Sigma
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2021Quote: ... SHH-tagged Gus-Cts1 was detected using a primary anti-HA antibody (1:4000, Millipore/Sigma, Billerica, USA). For detection of Gfp-tagged proteins like Don3-Gfp ... -
Cell Signaling Technology
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2018, published in The Journal of Neuroscience doi: 10.1523/JNEUROSCI.2199-18.2019Quote: ... with antibodies against Shh (Cell signaling 2207 ... -
abcam
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... Mouse-α-Shh (DSHB, 5E1) and mouse-α-V5 antibodies (Abcam, ab27671) were used to stain Shh and Disp ... -
Thermo Fisher
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... and recombinant SHH was purified with Detoxi-Gel™ Endotoxin Removing Gel (ThermoFisher) and dialyzed ... -
The Jackson Laboratory
No products found because this supplier's products are not listed.bioRxiv - Neuroscience 2020Quote: Shh::cre (Jackson laboratory) and Ntn1lox (given by P ... -
GenScript
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2020, published in The Journal of Neuroscience doi: 10.1523/JNEUROSCI.2888-19.2020Quote: ... 200 ng/ml recombinant SHH (GenScript, #Z03050-50), and 5 uM cyclopamine (Toronto Research Chemicals ... -
Proteintech
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... and sonic hedgehog homolog (Shh; 1:500, 20697-1-AP; Proteintech) overnight at 4°C ... -
Agilent
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... a Bgl2 site was introduced into SHH-FL after Gly198 by Quikchange (Agilent) using primers (forward 5’ GTGGCGGCCAAATCCGGCGGCAGATCTGGCTGTTTCCCGGGATCCGCC and reverse 5’ ggcggatcccgggaaacagccagatctgccgccggatttggccgccac) ... -
Roche
No products found because this supplier's products are not listed.bioRxiv - Developmental Biology 2019, published in eLife doi: 10.7554/eLife.50670Quote: ... Shh-/- and Shh-/-;Gli3-/- E10.5 embryos (33-34S) were processed separately by dissociating limb buds with 100ug/mL Liberase (Roche 05401119001), crosslinked for 10 minutes ... -
Atlas Antibodies AB
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... or anti-ALDH1A3-antibody (Atlas Antibodies, HPA046271) on the Ventana BenchMark (Roche ... -
Miltenyi Biotec
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2022Quote: ... sonic hedgehog (SHH) (Miltenyi Biotec), or transforming growth factor (TGF)-β2 (Thermo Fisher Scientific ... -
Promega
No products found because this supplier's products are not listed.Cited in A novel truncating variant of GLI2 associated with Culler-Jones syndrome impairs Hedgehog signallingbioRxiv - Genetics 2018, published in PLOS ONE doi: 10.1371/journal.pone.0210097Quote: ... cells were treated with SHH (16nM) in DMEM containing 0.5% FBS for 30 hrs and processed with Dual Luciferase Assay Kit (Promega) for measurement of Firefly and Renilla luciferase activities. -
Becton, Dickinson and Company
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: Antibodies used were as follows: anti-Paxillin and anti-GM130 antibodies (BD Transduction Laboratories ... -
Agrisera
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... anti-UGPase antibody (AgriSera), anti-phot1 polyclonal antibodies (Cho et al. ... -
Jackson ImmunoResearch
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2017, published in Biology Open doi: 10.1242/bio.026930Quote: ... Secondary antibodies include HRP goat anti-mouse or anti-rabbit antibodies (Jackson Immunoresearch). After washes ... -
BioLegend
No products found because this supplier's products are not listed.Cited in Low-dose IFN-γ induces tumor cell stemness in tumor microenvironment of non-small cell lung cancerbioRxiv - Cancer Biology 2019Quote: ... anti-human CD133 and anti-ICAM1 antibodies (BioLegend). A549 and H460 cells pretreated with DMSO ... -
Takara Bio
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ... -
Bio X Cell
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2022Quote: ... anti-CD4 antibody and anti-CD8 antibodies (BioXCell, Lebanon ... -
Genetex
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2022Quote: ... Primary antibodies consisted in two anti-spike antibodies (rabbit anti-S1 Genetex #GTX135356 ... -
Bethyl
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020, published in The FEBS Journal doi: 10.1111/febs.15360Quote: ... Anti-CRY1 antibody (Bethyl), Anti-CBS antibody (Abcam ab54883) ... -
Bio-Rad
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2018Quote: ... anti-mouse or anti-goat antibodies (Bio-Rad), at a concentration of 1:5000 ... -
GE Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... anti-rat and anti-mouse antibodies (GE Healthcare) used at a dilution of 1:5,000 ... -
Merck
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2020, published in Protein Science doi: 10.1002/pro.3957Quote: ... as primary antibodies and HRP conjugated anti-mouse or anti-rabbit secondary antibodies (Merck). -
Novus Biologicals
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2019, published in ACS Synthetic Biology doi: 10.1021/acssynbio.9b00100Quote: ... Antibodies (anti-fluorescein: Novus Biologicals, NB600-493 ... -
antibodies-online
No products found because this supplier's products are not listed.Cited in Latrophilins are essential for endothelial junctional fluid shear stress mechanotransductionbioRxiv - Molecular Biology 2020Quote: ... Anti-RFP (Antibodies-Online) (ABIN129578) ... -
Rockland
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... or Anti-Flag antibody (Rockland) diluted 3000x in TBST to detect the Myc-tagged PilE or Flag-tagged TfpC on a shaker for 1 hour at room temperature ... -
LI-COR
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... anti-rabbit and anti-mouse fluorescent antibodies (LI-COR) were used at 1:10000 dilution ... -
Synaptic Systems
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2018, published in Molecular Cell doi: 10.1016/j.molcel.2019.06.001Quote: ... Rabbit anti-m6A antibody (Synaptic Systems) and rabbit IgG control bound to protein A Dynabeads (Invitrogen ... -
SouthernBiotech
No products found because this supplier's products are not listed.bioRxiv - Immunology 2021Quote: ... anti-IgG-antibodies (SouthernBiotech). The relative concentrations ... -
Abclonal Science
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020, published in Cell Research doi: 10.1038/s41422-020-0303-zQuote: ... anti-ATP1A1 antibody (Abclonal, A0643), anti-ApoB antibody26 and anti-ApoA1 antibody (Proteintech ... -
Vector Labs
No products found because this supplier's products are not listed.bioRxiv - Molecular Biology 2020Quote: ... antibodies followed by biotinylated goat anti-rabbit/anti-mouse IgG (H+L) secondary antibody (Vector Laboratories). Sections were washed and incubated with Vectastain Avidin–Biotin Complex (Vector Laboratories ... -
Bioss
No products found because this supplier's products are not listed.bioRxiv - Biochemistry 2018, published in EMBO Reports doi: 10.15252/embr.201847472Quote: ... Anti-Golga7b (Bioss Antibodies), for ICC 1:100 ... -
Diagenode
No products found because this supplier's products are not listed.bioRxiv - Genetics 2020Quote: ... 2ug rabbit anti-H3K27me3 antibody (Diagenode), 2ug rabbit anti-H3K4me4 antibody (Diagenode ... -
Addgene
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: The pcDNA3-Shh (N) (Addgene, #37680) was used as template to amplify the cDNA coding residues 24-197 of mouse Shh ... -
Peprotech
No products found because this supplier's products are not listed.Cited in iPSC-based modeling of THD recapitulates disease phenotypes and reveals neuronal malformationbioRxiv - Neuroscience 2022Quote: ... N2B27 was supplemented with SHH (100 ng/ml, Peprotech), FGF-8 (100 ng/ml ... -
Qiagen
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2021Quote: ... IL-22ra1fl/fl/Shh-Cre or WT controls using RNAeasy mini kit(Qiagen, cat: 74106). Isolated RNA was converted into cDNA using a iScript cDNA synthesis kit (Bio-Rad ... -
ChromoTek
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2019Quote: ... anti-mNeonGreen antibody (ChromoTek) was used at 1:1,000 dilution to determine levels of indicated mNG-FtsZ variants at specified time points ... -
New England Biolabs
No products found because this supplier's products are not listed.bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (NEB). -
Active Motif
No products found because this supplier's products are not listed.bioRxiv - Genomics 2022Quote: ... 1 μg anti-H2Av antibody (spike-in antibody, Active Motif), 10 ng spike-in chromatin (D.melanogaster ... -
Abnova
No products found because this supplier's products are not listed.bioRxiv - Immunology 2020Quote: ... anti HERPUD1 antibody (Abnova, #H00009709-A01), anti CTH antibody (Cruz ... -
Sino Biological
No products found because this supplier's products are not listed.bioRxiv - Bioengineering 2021Quote: ... Anti-M13-HRP antibody (Sino Biological) was used for detection at 1:4000 dilution in blocking buffer ... -
Antibodies Incorporated
No products found because this supplier's products are not listed.bioRxiv - Genetics 2017Quote: ... Primary antibodies were 1:50 human anti-centromere antibodies (Antibodies Incorporated), 1:50 affinity-purified guinea pig anti-REC8 (Kouznetsova et al ... -
Calbiochem
No products found because this supplier's products are not listed.Cited in Phosphorylation of AMPA receptor subunit GluA1 regulates clathrin-mediated receptor endocytosisbioRxiv - Neuroscience 2020Quote: ... Anti-GluR1 Antibody (Calbiochem-PC246 ... -
KeraFAST
No products found because this supplier's products are not listed.bioRxiv - Immunology 2019Quote: ... anti-Zika E antibody (Kerafast) was used ... -
Absolute Antibody Ltd
No products found because this supplier's products are not listed.Cited in SARS-CoV-2 Spike triggers barrier dysfunction and vascular leak via integrins and TGF-β signalingbioRxiv - Microbiology 2021Quote: ... anti-Spike (Absolute Antibody, CR3022), rabbit anti-TGFBR1 (Thermo Fisher Scientific ... -
Origene Technologies
No products found because this supplier's products are not listed.bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ... -
Dianova
No products found because this supplier's products are not listed.bioRxiv - Cancer Biology 2021Quote: ... Detection of anti-CD31 antibody was performed using a goat-anti-rat-HRP antibody (Dianova, Hamburg, Germany). Visualization was done by using the AEC Substrate Kit (abcam ... -
Enzo Life Sciences
No products found because this supplier's products are not listed.bioRxiv - Cell Biology 2020Quote: ... anti-goat or anti-mouse antibodies (1:5000; Enzo Life Sciences) in the blocking buffer at room temperature for 2 h ...