-
No products found
because this supplier's products are not listed.
Chad Schimeck, et al.,
bioRxiv - Genomics 2022
Quote:
... The ready to use 5’-Cy3-labeled single strand telomeric probes (TTAGGG)7 (PNA Bio) were purchased from PNAGENE Inc (Daejeon ...
-
No products found
because this supplier's products are not listed.
Laura Maria Florez, et al.,
bioRxiv - Immunology 2023
Quote:
... between passages 3 and 7 in complete mouse endothelial cell medium (from Cell Biologics, Euromedex) composed of mouse endothelial cell medium with the addition of endothelial cell medium supplement kit (from Cell Biologics ...
-
No products found
because this supplier's products are not listed.
Koray D. Kaya, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Thin-sections (70 to 80nm) were made with an ultramicrotome (UC 7) and diamond knife (Diatome), attached on 200-mesh copper grid ...
-
No products found
because this supplier's products are not listed.
Michelle M. Dominguez, et al.,
bioRxiv - Plant Biology 2022
Quote:
... then were carefully sub-cultured to 3×4 Magenta GA-7 vessels (Bio-World, Dublin, OH). The seeds remained under these conditions until epicotyls grew to approximately 7.5 cm in height ...
-
No products found
because this supplier's products are not listed.
Fabian Stefan Franz Hartmann, et al.,
bioRxiv - Microbiology 2021
Quote:
... Spotting was conducted by setting an overshoot of 1.5 mm and a pin-pressure of 7 % using long 96-well pins (Singer Instruments). To avoid reflection from the plastic edges of the OmnyTray plates as well as effects resulting from the outer barrier of arrayed colonies ...
-
No products found
because this supplier's products are not listed.
Jean-Hugues Guervilly, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were usually fixed and stained 7 to 8 days later when visible colonies could be counted with a Scan 1200 automatic colony counter (Interscience).
-
No products found
because this supplier's products are not listed.
Christin Herrmann, et al.,
bioRxiv - Microbiology 2020
Quote:
... with 0.15% v/v TFA and separated into either 3 high-pH fractions (enriched ubiquitinated peptides) or 7 high-pH fractions (global proteome) over C18 columns (The Nest Group, MicroSpin column C18 silica ...
-
PNMT, also known as Phosphatidylethanolamine N-methyltransferase, or PEMT, PEAMT, or PEMT2, and...
Cat# PAB1034,
Inquiry
Ask
Konner Cool, et al.,
bioRxiv - Microbiology 2021
Quote:
... VA) and Vero E6 cells stably expressing transmembrane serine protease 2 (Vero-E6/TMPRSS2)7 were obtained from Creative Biogene (Shirley, NY) via Kyeong-Ok Chang at KSU and used for virus propagation and titration ...
-
No products found
because this supplier's products are not listed.
Weng Hua Khoo, et al.,
bioRxiv - Immunology 2022
Quote:
... Proliferating cells remaining in the cultures were further expanded by incubating for a further 7 days with 20 IU/mL IL-2 (Roche Life Science Products). After expansion ...
-
No products found
because this supplier's products are not listed.
Blandine Madji Hounoum, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rinsed and postfixed in 1% osmium tetroxide and 1% potassium ferrocyanide in 0.1M cacodylate buffer before to processed for ultrastructure as previously described [7] and analyzed using a JEOL JEM1400 transmission electron microscope (JEOL, Tokyo, Japan).
-
No products found
because this supplier's products are not listed.
Ashok Daniel Prabakaran, et al.,
bioRxiv - Physiology 2024
Quote:
... Tissue sections of 5–7 µm thickness of was stained with hematoxylin and eosin (H & E; cat #12013B, 1070C; Newcomer Supply, Middleton, WI). CSA quantitation was conducted on >400 myofibers per tissue per mouse ...
-
No products found
because this supplier's products are not listed.
Bryce A. Jones, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Litter-to-litter variation was controlled for by balancing treatment groups across litters. Nicotinamide riboside (CAS No. 1341-23-7) was obtained from ChromaDex (Los Angeles, CA) through participation in their External Research Program ...
-
No products found
because this supplier's products are not listed.
Pallab Pradhan, et al.,
bioRxiv - Immunology 2020
Quote:
... 10 layers each with 175 cm2) for 5-7 days in Xeno Serum Free Media(XSFM) media (Prime-XV, Irvine Scientific, Santa Ana, CA) to passage 3 (P3) ...
-
No products found
because this supplier's products are not listed.
Maxence Le Vasseur, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Gel slices (2mm x 7mm) were excised along the entire lane using disposable gel cutter grids (The Gel Company, San Francisco, CA, cat# MEE2-7-25). Ten gel slices ranging from ∼600-900kDa were collected in 100µl of 50mM ammonium bicarbonate (pH 8.0 ...
-
No products found
because this supplier's products are not listed.
Tetsuro Yamamoto, et al.,
bioRxiv - Immunology 2023
Quote:
... HRP-human IgG antibody (EY Laboratories, USA), and BT IgE antibody (Bio-Rad Laboratories ...
-
No products found
because this supplier's products are not listed.
Giovannino Silvestri, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... anti-SET (Globozymes); anti-ABL (Ab-3) ...
-
No products found
because this supplier's products are not listed.
Sanne van der Niet, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Dihydrochloride) detection was performed using anti dinitrophenol (DNP) (Polyclonal Anti-DNP, Oxford Biomedical Research). All antibodies were diluted in 1% BSA in PBS ...
-
No products found
because this supplier's products are not listed.
Katrina Mekhail, et al.,
bioRxiv - Cell Biology 2022
Quote:
... anti-C9 agarose bead (Cube Biotech), HA antibody (Abcam ...
-
No products found
because this supplier's products are not listed.
Renee C. Geck, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Antibodies were used at indicated dilutions in 5% milk (Andwin Scientific) in TBST buffer (Boston Bioproducts) ...
-
No products found
because this supplier's products are not listed.
Michelle Zuo, et al.,
bioRxiv - Immunology 2021
Quote:
... magnetic beads were conjugated with monoclonal capture antibodies (mAB47:3, UmanDiagnostics), incubated with diluted mouse serum (1:8 or 1:16 dilution ...
-
No products found
because this supplier's products are not listed.
Erick X. Pérez-Guzmán, et al.,
bioRxiv - Microbiology 2019
Quote:
... anti-ZIKV IgG (XPressBio, Frederick, MD, USA) at baseline ...
-
No products found
because this supplier's products are not listed.
Hongbing Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
The E-ALPHA® human scFv antibody phage display libraries (Eureka Therapeutics) were used for the selection of human antibody constructs specific to SARS-CoV-2 spike protein ...
-
No products found
because this supplier's products are not listed.
Bálint András Barta, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... The antibodies were stained by incubation with 100μL of substrate solution (Neogen) containing 3,3′,5,5′-tetramethylbenzidine (TMB ...
-
No products found
because this supplier's products are not listed.
Ellen Gingrich, Kendra Case, A. Denise R. Garcia,
bioRxiv - Neuroscience 2020
Quote:
... sheep anti-BrdU (1:500, Maine Biotechnology Services), mouse anti-CC1 (1:1k ...
-
No products found
because this supplier's products are not listed.
Ying Zhu, et al.,
bioRxiv - Systems Biology 2022
Quote:
... anti-TIMM23 (1:1000, mouse, DB Biotech, 611222). After washing 3 times with TBST ...
-
No products found
because this supplier's products are not listed.
Li-Chun Cheng, et al.,
bioRxiv - Cell Biology 2023
Quote:
... rabbit anti-nesprin-3 (United States Biological Corporation), rabbit anti-myosin heavy chain (Abcam #124205) ...
-
No products found
because this supplier's products are not listed.
Anu G. Nair, Paola Muttathukunnel, Martin Müller,
bioRxiv - Neuroscience 2021
Quote:
... and Atto594 conjugated anti-mouse (ATTO-TEC; 1:100). Images were acquired using an upright Leica Stellaris or inverted Leica SP8 laser scanning microscope (University of Zurich Center for Microscopy and Image Analysis ...
-
No products found
because this supplier's products are not listed.
Ragna S. Häussler, et al.,
bioRxiv - Biochemistry 2019
Quote:
... the antibody-coupled beads were washed three times in 100 μl 1x PBS (09-9400, Medicago), 0.05% Tween20 (BP337 ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
No products found
because this supplier's products are not listed.
Rosalie Martel, et al.,
bioRxiv - Bioengineering 2022
Quote:
Antibody microarrays were patterned on PolyAn 2D-Aldehyde slides (PolyAn) using the sciFLEXARRAYER SX inkjet bioprinter (Scienion). Slide were imaged in the 532 nm channel at 100% gain prior to patterning to qualitatively assess the uniformity of the aldehyde functionalization ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Fluorescent labeling of monoclonal antibodies was performed with the DY-647P1-NHS-ester reagent (Dyomics, Ref#647P1-01) according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
István Fodor, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 2) incubation with a rabbit anti-ap-GnRH/CRZ antiserum (#AS203-2, EZbiolab; antigen was a synthetic undecapeptide ...
-
No products found
because this supplier's products are not listed.
Sebastian Fiedler, et al.,
bioRxiv - Biochemistry 2020
Quote:
Anti-SARS-CoV-2 seropositive human serum samples (convalescent) were obtained from BioIVT. BioIVT sought informed consent from each subject ...
-
No products found
because this supplier's products are not listed.
Alexander Scheiter, et al.,
bioRxiv - Pathology 2021
Quote:
A compound library including 315 approved anti-cancer drugs was purchased from TargetMol (L2110 ...
-
No products found
because this supplier's products are not listed.
Jayne E. Wiarda, et al.,
bioRxiv - Immunology 2022
Quote:
... mouse α-pig γδTCR-iFluor594 (primary antibody Washington State University PG2032; custom conjugation to iFluor594 performed by Caprico Biotechnologies); mouse α-pig CD4-PerCP-Cy5.5 (BD 561474) ...
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
Moisés dos Santos Corrêa, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... which allows detection of specific antibodies in blood plasma using the Corticosterone Enzyme Immunoassay Kit (Arbor Assays LLC, MI, USA). This kit is supplied with clear plastic microtiter plates coated with donkey anti-sheep IgG ...
-
No products found
because this supplier's products are not listed.
Branislav Kovacech, et al.,
bioRxiv - Microbiology 2021
Quote:
... Binding of HRP-conjugated RBD to immobilized antibody 1 was detected with TMB one substrate (Kementec Solutions A/S, Demark) and stopped with 50 μl of 0.25 M H2SO4 ...
-
No products found
because this supplier's products are not listed.
Emanuel Rognoni, et al.,
bioRxiv - Cell Biology 2021
Quote:
... blocked with 5% BSA/PBS (1 h at room temperature) and stained with the indicated primary antibodies and 5 µM B-CHP (BIO300, 3Helix) overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Yeon-Jee Kahm, Uhee Jung, Rae-Kwon Kim,
bioRxiv - Cancer Biology 2023
Quote:
... cells were incubated with antibodies in a solution of Tris-buffered saline (cat. no. A0027, BIO BASIC, Markham ON, Canada) at 4°C for overnight ...
-
No products found
because this supplier's products are not listed.
Esther B. Florsheim, et al.,
bioRxiv - Immunology 2023
Quote:
... Capture antibodies were the same as for total IgE assay and 8 mg/mL of biotinylated OVA (OVA1-BN-1, Nanocs) was used for detection ...
-
No products found
because this supplier's products are not listed.
João L. Pereira, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Tris-buffered saline with 0.1% Tween 20 was used for washing and antibody incubation as well as membrane blocking with 5% bovine serum albumin (cat. no. MB04602, NZYTech). The chemiluminescent signals were acquired by incubating the membrane with SuperSignal West Femto Maximum Sensitivity Substrate (cat ...
-
No products found
because this supplier's products are not listed.
Irmgard U. Haussmann, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... a T7 promoter oligonucleotide (CCTGGCTAATACGACTCACTATAG) was annealed to an anti-sense Ultramer (IDT DNA) encoding the entire sgRNA in addition to the T7 promoter ...
-
No products found
because this supplier's products are not listed.
Zhengtang Qi, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The membrane was blocked for 1 h at room temperature followed by incubation overnight at 4°C with primary antibodies including FAM132b (AVISCERA BIOSCIENCE), PI3K ...
-
No products found
because this supplier's products are not listed.
Grzegorz Maciag, et al.,
bioRxiv - Cell Biology 2024
Quote:
... After antibody staining the tissue was washed 6 times in PBS and before imaging the tissue was incubated in RapiClear (SUNJin Lab) for 30-60 minutes at room temperature ...
-
No products found
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
M Kouwenberg, et al.,
bioRxiv - Immunology 2020
Quote:
... To analyze DC maturation cells were stained with anti-CD11c (clone N418, IQ products, Groningen, the Netherlands), anti-CD40 (clone FGK45.5 ...
-
No products found
because this supplier's products are not listed.
Anh T. P. Ngo, et al.,
bioRxiv - Cell Biology 2023
Quote:
Thrombin anti-thrombin complexes in septic plasma were measured using commercially available ELISA kits (AssayPro; EMT1020-1) according to manufacturers’ instructions ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Mitsuhiro Abe, et al.,
bioRxiv - Cell Biology 2024
Quote:
... The cells were washed and incubated with HMSiR-coupled goat anti-rabbit IgG (#A204-01, GORYO Chemical, Inc.).